Description :
From Genome Similarity Track
Location :
contig_47:318887- 321829
Transcript NameFunction/comments
g7885.t1succinate semialdehyde dehydrogenase, mitochondrial precursor

Sequence
2942 bases(100 bases per row)
TATCACTCTAAATCTCACCAACTGCAGACAAATCGGCCGAAGGTTCCTTCAGAGACTTATTAACAAGCTTGAATTCGTGCAATGGGCCACCAGTTTCTTC
GGCTACGAGCCGTTGCCGAATGCCGCAGAGCTGTGCCGTCAGCGCGACCTCCGTTTGTTGCAGCTTCGGAGTGCCATCAAAATCCAGTCGGCGATACGTG
GATGCCTTGCACGTGGTGGACTTTGGCAAGCGAAACTCAAATTTGTGGAGCGAAAAATTCTACCCAAGATCCAAGCGCGTGTGCGAGGGTTCTTGCTAAG
GAAGAGCTTGGCAGCGGAAAAGCAGTATCAACTAGAGGAGCATGCTGCTCGCTCAATTGGGCGTGCATATCGCGACTTGCAGCTTCGACGCATGTTGGTG
CGTGCGAAGCGCTTGCGGCAAATCAAGGAGCATGAAGATGAGGCTGCTCTCATTTTCCAGAAGATTTTCCGAGGGTATCGTGACCGAAAACTTTTGGCCA
AGATGAGGTATGATATCTACTGCGAGCAGCAACTCCAAGCTCGTGTTCTGGTGATGCGAAATTTGGCAGCCACAAAGTTGCAACGTGCGTACCGAGGACA
TCGCGGGCGGTCCGATGTTGCCATGTTGCGCTCAATCAAGGAAGCAAAGCGTCTTCAGCACGAGAAAGAAATTCGCTCAGCATCTTTTATCCAACGTGTA
TATCGAGGCCACAAAGGACGCACGGTTCGTGCTCAGCGCCTTGCAGAATTACTTCATCAGCAACAATGCGACCAAGGAGCCATCAAAATGCAAAAGGTGT
TCCGTGGCCATCGAGCACGACGGAATGCAGTACTGTTGCGTACTGAAGCGAGTGAGTTACGGATACTTAACGCCGCCTTGACTATTCAAAGATACTGGCG
AGGAATCCGCGATAAGCATTTGGCCGCGGTGTTGATTGGGTTAGTCAAGCTGCGTGCCAGGGAAAACGAGGCTGCCTACTCGATCCAAGCTGCTTATCGT
ATACATGCCTCCCGAGGATTCATGAAGGCGATGAAGCTGGCTTTGGCAGCGCAGCTGAGAAGAGTGAAAGCAGCTACCGATATTCAACGTCTCACACGTG
GACATCGTGGACGGGCAGAGGCTGAGCTTCGGAGGGAGTTGCAACGATTCCGTCACCAAGCTAAACCGTTATTCGCGAAAGAAGCACGTTTACAAGCACT
TGTGCATGACCTGAACGAGAAAGTGGAACAGCTACAACGTAAACTCACTGCTGATGAAGAAGAAGAGCGTGCTCTCACGCTTGAACTCGAGAAACGCTAC
AGATCAGAACAAAGTACCATGACTCGAGTCGTATCACGGGCACACCCCAACGCTATCTGACGCAGTATCTGCAAGTACAGCTTGCCGATCAGCTACGGGC
AAAGCGAACTGAGATCGCCCTTGATGAACGGGCTTTTGAAACCTTAACGACAAATCTGAATGACGCTCAAAAGCAATTGCGGGGCGTTAGGCGGGAGCTG
GAGCCGCTAACGGAAGGTGTTATCAAGAAAACACGTGAAAACCGCGTGAAGAGGTTGCAGGATAAAGTTCGCCATGAACGTCGAGCGGCAACTACTATCC
AAAAGGTCTTTCGTGGCTTTCGCGTGAGGTCAGCGGTTCGAGAAGGTGGAAATTGCTGGACGCAAATGGTTTCACCTGACAATGCGCGACCATATTTCTA
TAATGCACTGACAGGAGCGACAAGGTGGCATCGTCCTTTAGCAATGGACATCTTCGGAGGCCAACTTGCAGAGCCCCAAAGCGTGCATAAACCGCTGGGT
GACTCTACTGATACCATGAATTCGCGTCGTTCCACCGGCAGTATTGGGACTACTCGATCACTCCAGTGGCAGTATCGATATGGTTACGAATACGACGCTG
ACGGTAAGCTTGTCAAGAGCTCCAGGTCACAACCGCGGCCTATATGGACCGAACACACTGACCCTGACTGCGGCATGGCCTATTACTACAACGTGCTCAC
CAATGAGTATCGATGGGAGAAACCTGCAGACTTCGACATCAACTATGAAGCTTTTGCTAGCGGACGTAGTGCAAGCAGCTCCGCTCGTAAGTGGTTCGAG
ATGGCCCATCAAAAGCAAAATGCCGACGGCAGCAGCTCTCTCAGTTCTCGATCGTCGAAGACGCGCGCTTTCGGAAAGAAGTGGGTGGAGCTGGTCGATC
CAGAGACGCAAAACACGTACTACTACAACGAGGTGACAGGAGAGACGCGGTGGTCCCTCTCCTCGCAGTGCATTGGACACTTCAGATACGGAAGATCAGA
TCTCCTTGGCCCTGCTCGCGCAGGTGAAGCAACTTCGCGAGACGCCAGTGCCGTATTCATCTCGGGACCAGCATATGAGCTGGCTGGAAGCAGCTATCGC
CGAGAAGGGCTGGAAAAAAGCAGACGCGATCGTCCAGCAAATCTTCATTCGTGAACAGAGCCAAGCTGTAACTGACCGTCGAGCTAGAATCGCAGCCGAG
GAAGCGGCGAGAGCACCTGTCACCTCAGATACAGCGAGCAATTTCTTGACAAGCAGCAATGTTTCCTCTGTTTCGACTCCGAGCGCTTGGATCGAATGCA
CTGACGAAAGCAGTGGCGCTACGTACTTTTACAACCAGGTGACCGGAGAGACAACGTGGACCAAACCATCAACAGCACCTGCAGGTCAGTGGGAAGTGGT
GCAGGATAACGATGACAAGGCGTATTACTACAACCCTGTCACAGGCGAGACGGTATGGTCAGAGCCCACCCGGTGAGTTCGAAGGAACATATAACTTTAT
TCCACAGTACACGTCTGGGTCAAAACAATCTGGCAATGGAAACTTATGCCTCCAGGCCGCCCATGCAGACCATCTTCGTCTCCTGATACTCGTCCAAGCC
CATGAACGAACCTTCACGACCGAGGCCAGACTGCTTCACGCC