Description :
From Genome Similarity Track
Location :
Scaffold_120:31884- 32960
Transcript NameFunction/comments
Phypl_g3581hypothetical protein

Sequence
1076 bases(100 bases per row)
TACCAGCTTATTCGTGCgatcggccacggcgccTACGGAGTCGTGATTGCAGCGAGCGATCAAGTCACAGGAAACTCGGTTGCTATCAAGAATATCCCCC
GCACCTTCGACGACCTCGTTGATGCTAAGCGCATCGTACGCGAGATTCGGCTCATGAGGCATCTGCGCCACCCGCACGTTGTATCGGTGCTGGACGTAAT
GCGTCCTCCATCGCTCTCCAATTTCGAGGATACGTACATCGTCACTGATCTCATGGAGACCGATTTGCACAGGGTTATCAACTCAACAGAGGCTCTGTCG
AGCGATCACATCGCTTTCATCACGTACCAACTGCTCTGTGGACTGCGCTACGTCCACTCAGCGCACATTATTCACCGCGATATCAAGCCGTCGAACGTTC
TTATCAATCGCGACTGCCTCGTCAAGCTTTGCGATTTTGGACTGGCACGGGGCATCGACATCCGACCCGTTACACCAAGCAGCATTGATGGGAACTCTAC
GCCAAGCAGTCAAGATGGAGAGCCTGCACTTGACGAAGCGTTGACGGAATATGTGGTGACCCGTTGGTACCGAGCGCctgagcttctgctcgcgAGTCGG
TACTCGACGGCTATTGACCTCTGGGCTGTCGGATGCATCCTAGCGGAGATGTTCACACGCAAGGCTCTCTTCCCGGGCCATGACCACGTGCACCAGCTGC
ATTtgatcctgcagctcgtgggcAGTCCGCTGCCTGGCGACATGGGGTTCGTCACCAATACGAAGGCCAAGCGGTGGATGgcgcgtcagcagcagcaaga
aggcaAGTCGCTCAACACGGTGTGCCCGAATGCCCcgatcgaggcgctggatctcttggcgaagctgctgcagttcgaccCGCGCAAGCGAATCTCAGTG
GACGATGCCATCGCACATCCGTTCCTGGCACCGTGTCGCGCGGATGGCGTCAACATGGGCTCCGAGCGTCTGGCGGACAGCGCGTTCGACTTCTCGTTCG
AGCGGGAGAACAAGGGCAACATGGACACGAACACCCTGCGTCGCCTCATCTTCGAGGATGTCTGCCACTTCCACCC