Description :
From Genome Similarity Track
Location :
Scaffold_45:31882- 33050
Sequence
1168 bases(100 bases per row)
GTCACAGACGACACTGAAAGGCTGATCAGAATCTAGCAAAGCCAAAATCGGTGCATGTAGGAGACTCTCCTTTACGTCCTTAAAAGCATCTGCTTTGGTG
CTAGTCCAGCACCACTCCACATCCTTTTTCAGGAGATCGGATAATGGCGAGCCATATCCCTCAGCGTAATTCTTGCTATACTTGTGCAAGTAATTGGCAA
TGCCAAGCCATTTGCGTAGGTCCTTTTGATTCTTAGGAATTGGCCAATCCTCTATAGCCTTCAACTTTGCAGGATCCGCCCAAAGACCCTTCTTCCCAAT
GAAGCGTCCCAAAACTGGGATCTCGTCCGCACCAAAGATAAATTTTGATGTATTAGCATAGAGCTTATTAGTGCGCATGCACTCGAGCACAGCTCGTAAA
TGGTCGATGTGGTTATCCACGTCCAACCGACCCTATTCCGCTTGACTATGGACAAATATGTCGTTAAAGTATGTTTGTGCATAAGCACGGTGAGCACGTA
ACAGTAGCATCACCAGACGATTAAACGTAGCCGGGGCATCGGAAAGCTCCTGGGGCATAACCAGTCACTCCCAAAGCATACCGCTTGGAGTACTAACCGC
TGCAAGCGGAATATCATTTGCTCGCATGAGCAGTTAATACTAACCATCGACTAGGTCGAGTGCACTGTACACTTTATATCCTGCCATGTTGTTCTGAAGA
ACGTCCTTTCGAAGAATGGGTGTTTTTTCCGCTATAGTGTCCGCATTAAGCTTAATACTAGTGTGCACAATACGCCACTTACTATTAGTTTTTTGGGCAC
AAAATTTCGGTATGGAATAAGGAGATTTACTCTCCCGCACCATTCCCGCCGCGTGCTTAGCACTGAAAAAACCGTCAATGACGTCACATTGTTCCTTTGG
TAAATGCTACTGCCTTGTAACACAGCGTTTGGTTCCAGGAACCAAGTCAATTTCATGACGTATGCCCCTATCGGGAGGTAATACAAACGGTAGATTATGA
CATACCACGTCTTGAAATTCCTTAACTAAACGGTTGTAGGGGTCTGAAGGGTTCTCCAAAATAGATGGTCCACATCGTGCACTAAGTGCCGCTTTTGTAC
TTTCAAGGACCGTCTTAGCCAATAAAGACGAGGAGTTCAACTCATTCTCGGGTCTAAGGACCAACATA