Description :
From Genome Similarity Track
Location :
scaffold_18:318810- 320285
Sequence
1475 bases(100 bases per row)
TTCTTAGCCGTTTGTGCCCTGTatagatcatgcatcattgCGTCGTCACTACATATAATAAAAAAGACGGAATGGTAATTATTCTTTGCCGAGTACACCT
TTGAGGTAAAGTAACCCGGATCGGCTTAATATGGTGTTGAATGCGCATTTGCGATGTATCAACTATAAACTGTCACCTGtcacaatggtgacgtcaaCAA
TTGATAAGCTGATTCGTCCGGCGTACGGATCAGACATAAAATGTGGTATGCTGCTGAAAGTTGCAAGTCAAGGCGTTTGAGAACTCATATGTCGCTTGAT
CAAACGCGCTGTTGCAAACCCGCACCGCTCTGACTTATCCAAACGATTATTGTAATTTCGCCGTTTCACATGACATACTAGCGTATAAAAATGCCTCGCG
ATGAGAAACTCGAGTACAGAGTACTGTATGAAGCACATGATAATACCCTTCGGCGACCATCTTGGAAGATAACGAGTATGCGCTATGTATAAGTGACCCA
CAAAATAATGCGTCAGAGAAACCTCAGATAGAAGCAATTTatggaaacaagttaagcAAAAATATAGTTACTTGATCAATGGGATCAATTCGCTCTGTCT
CTGCGCGAATGCTTTGGAGAATATCCTTTACCACTTGATACATTTGTTCTTCCGACATTCTGTTTGTGAATCATCAGCAGTTGACATGCCCAATCTGGCG
CCTTAAATCTTGACAATAATTTGCTAAACTTTACTGTAGGAACACTAATCTTTTTCCGACACACGAATGCTACCGGCAAACCATATTGGTGATAACATTT
GTTGAGTATTTTTGAAATAACTCGTTTCGATAACTGcagcaaaatgatttttttctcagaATTTCCAAATTTACGCATTACCGGTAATACCTTCGAAAGC
TTATGGCGGTCGGCAAACTCCAAAAACAATGAATGGTAAAAATGGATGAAACTAATCGCGTTCACACTTTTCCGCGTGCAAACATTTAAGCTTACCCGCA
TATCCTTGTCGGGCGACCACTACATAACGTTCACTAAGCAGCATatcttttttcaaaatgacCACTCAAAGGGTATCAATCATGTGCTCGTACAGCTTTC
TGTACTTGAAGGCCTCGAGGTAATACCATACGGTGAGTATCATGTGAATCGATGCTTTGGTGCTTTAAAATAATTAGTAATCCGCTGAATACGTTTAGAG
GTAAAATATGAAGACAAAGGAGAAAAAAATGAGACGCAAATGTGCAACTGCGTGCACCGTTAAATCGGCATTTGAGTTTCAAACTTTTTGCTGCTAAAAG
CTTTTAGCAACGCAACACTTCTGCTTCGTCTGCTGAGCGAGAGTCCGTAATGCAATAACCCGGATACAGCAACAACAAACGACTGAGAAAGATGGTCGTA
AAAATAATCTCATTCGAGTTTCATCAGTATTAAGCTTCGAAGAAAATCTACAGGAGAAGGGGTGACTTGCGATAA