Description :
From Genome Similarity Track
Location :
Scaffold_269:3187- 10937
Sequence
7750 bases(100 bases per row)
CTATGGCCAAAGTGCAGGCCGCCCAAGACACAGGTTTTCGGTACAAAACCGAAAAGTTCTGAGGGGAATGACGGTGCTGAATTAGACACACTCCAGCCAA
ATTTTAGTCGCCGTGAAGAGGAAAATGCAGTGCACAGATGCCACGACAATTCGATCTGTCCTCCCTACCGAAAAAATCGAGTCGTGCCAAGCCCAGATTG
CTTTTTTCCAGAATAGGTGGTTTAGTGATTTCGATCAAAAAATCTCTACTGCTGCCGTTTCAGTTAAAACGGGCGGAGTTGTATACGACTCTCAAATGCT
GAAGGCAATAAACTCGTGGCACTTAGCAGTTCAACGATTCAACGAGATCCGAGAGACCATTTAGTGGATAAATAACGTAGACTTGACGGGGTGGAATCCC
GATGATAGCTGGTGGAACGGTTTACTTTTGTTCGAAGAACTGGAGACTCGTCTGGAGGATATCGACGTTTTTGGCGACTTCTTTTGGGTGACCACTCTAC
ACGATCACTGTTTAGTAGAGCTGTCGTGTATGGACCTTGCGCTTAAGGCGCTGATTAGCCGGTATGGTGGTGACCATGATATTTTTGCTGTTCGTCCTAC
GTGATAAGATATCCCGAGTTTGATCGAGAGGCAATCAGTAGTTTGGCACCAGATTCGATCTGCAGCAGAACAGAAAAAGCTGTGGATTGATGACGCTCGT
GGTAGTGTCTCCGACGAGCGACGAAAACCAATTTGGCTATTTGCTGTGATCCTGTACCGAAATGAACACTGGTGTGCAGCAGCAGTAAATTTTGACGACC
TCACGATCACGGTGTTTGACCCGCAACGCACTGGAGACAGATTCAAGGCGCTGCAAAAGTATCTGCATGCCAATTTGGTGCCGCTGCTACCGCAGCCCCC
GTACCCAAAGCGCTACAGGCTCAAGCAACTCGAATGGATGACGCAGGTCGATTCCTACAACTGTGGCGTCTTCGTGATTCTGTTTTTCGACATGGTTCTG
CTAGACGTCGCTATAGTGGGGTCTGATTCGGCGTCCGAATCTACCATATCGATGCAGTACTTTCGATACCGTTTCATTAGCCATTTATTAAGCTTAATGT
GAGCTCAGGTTCCACACTAGTGTAATTGCTGCTAAGTCTGAGCACTGTAATTTTTAGTTGGCCGTGAGCACACTTCATGAAAATCACCGCGTTGGAGATC
TGTTTTGTACTTGCCTAAGTCCTTGCTAAGCACGAGATCGATCGTTTTGAGGCACGAGCTCGCGCATTTCTGATTGTGCAGTACGCTCTGTAGCACTGCC
CTCGTCGTCTATGCAGAGAAACCTGTGTGCCAGCTGGCAAAGAGCTCAGTCTCTGGAGTGAATCCTGACGTCCATATGGTTGTGCTATTCAACACATGGT
GAGACTATCCATCAGAAAGGACTCCGGACTATGTAAGACTGTGCGTGATTCTGTATGACTCTGCATAAAGTGCTGATTCATAGCCCCCAGACTGTGTACG
CAGTCTCTCTCCCCGTCCTGCCGCTATGAAAGCCTATCATCGATGGATGGGCGGGGTCGACGTGCACGACCAGCTTCACCTGCAGCGCTACCCGTTGCAG
TTATCTTTAAGATCTGAGCAAGTTTTGCAAGAGGGCTAACTGAGACAGGATTGGCGTTGCTAGCCTCTATGGCTAGTCAGCGTGACGAGCAATGCGATAT
GCGTTGAGGGCGCGTTGTTTCTTGAGGATCGTGTGCTTTGAGGCGCGAAGCTGTGATTGCATCTTGTGCAGTTGAGCACAATTAGGAATTGAGTTTCTGG
CCAAAATACTTCCTTTTTCGAATTCACCCTCGTATACGCGCCAGCACAGGGTTCACGCGCGATTAGCATCTCCATTTGGCGGGGGCTAAATGGAGCCTCT
CGTTGTGGTGCCACCTTGAAACACACGGCATTGATTGCGTTATTTCCGACTTTGAACGGAGTACTGACGTAGATATGTGAAGATTTGTAAAAATTAATAT
TCGCACTTTGTTTGATTGCGAACGGTCTTTGTCCTAACATTTCCTTACTGTAAACCATACTAAATAATAAGAACGTTTCTTGCTAAAATTAAAGATAAAA
AATCCTAAAGAAATATGTTTTAGCTTTTATTTTTCCGGATCACTCCCAGAAGACTTATTAGCCTTAAAATGCAGGCCAAGAGTTTCGTGAAAGACATGTT
GATTGCAGAAAGTGGAATGGTCAAAAAGTGCGTATGATTAAGTACGCAGTTGCTTTGCAATGACCTTAAAAAGAACAGGTTTGCACTGTCACCGACGAGG
ACTTTGCTCCATGAGCTGCGAATCACTGCTGGTGTTGAGGGTAGAAAACGCACAATCACATCAGTATTCGCACACATTTGAGACTGCGTCAAACAAAACG
ATACGTACGAACCATTTAGAGTTATCGAGGTAATCGAGCTATTATCGATTAAGTTGGCCAATTGATTTTCGCACTTAACCGGAACTGTGACATTTGGCAT
AAACTTCCATCGAAAAAAACTGTAAAACTACCCTTATTCAATTGCTTTTAACAAGGGATTTTAGCTCACAGCGTCATTGAAAAGTAAAATTCAAGTAGGT
GGATAAATTTCCCTACGTTTGAAAAATAGAAAAAGGAAACACCCCCACTCCCCCCTTTCACCCATCCTCCGCCAATTCCAAGCCTTTCATTTCAGATTCC
AACCCGAGAATGGAAAGTGCTGCGTCGTCGTCGAGCGCAGAATCTGAGAGAGACCAAGCAACGGCGGCTTCCCCCCACACTCACATCCCTTCTACAGCTT
CAGAGTGCGCGCCATTTATGGTACAGCTCTACTACACAAGCTGGGACAGCATTTTCGCCGCTTTGACTGAGTATCAAAACGCTACTCATCAAGTTTTCGC
AAACGAACATCGACAAGTGTCGCTTCACGCAGCGATGAGCTGAACAAACGAGGGACACTGACGCCTCATTTCTAACAAAAGTCCGATTCCGGTGAAACAT
ATACGTCCCCGATGGAGTCTCTCGTGTCCACTCAATATCCCGGTCAATGAAGATAAGTCTGTTGGTGATGAGGCTGCGTGTAGTTTGTTTCGAGTAAGTG
AATCTTCCCTAACGGCGTCTCGGCACAGTGTCCTGAATGGAACGAGCAAATTTCGAGTATCGCATGATATTGCGACGCGTATTGCCGATATCAAGAGTCG
TAACGGTACTCCGGTTTTCCCGAAGATGTTGGCATCTTTAAACGTTTTGAGGAGATTATTATCGATGGTGATGCTCCGTTTGTATCGGACGCTACTGTTT
GGTCGGAGAGATTGTCTACACTCGATCCAAATCTCTCTCAGATATCGTCGCTATAGCCTACAAATGAAGAAAATTTGAGTCCCAGTAGCGAGGATGCCCC
CTCCCAACTATCGTCGCGAAGATGTCAAGTGAAGTGTCCAGAGATGAGGCTCACGTAACAGCAGGAAGCTACACATACGAAGTGGCTTCATCCTTAGACG
GAGTGAAAATCTGCAAGACACTCAGCCGTTGTGACAATAACAAAGCATCACCTAGACGGAGTGACATCCTTCGCAAGGCACGCCGACGGAGTGTCAATAA
CAGCTGGTCCATCAGACGTAGTGGCTCGCAAGCAGGACCCTATCGTATGTCTACGAGATGAAAAGGCTGTCGATATGTCCTTACCAGCAAAGAGGCGTAG
GCAAGTGGATTCAAACCAGCGCTCCAACTGTAGTGAGGATTTATCTTTCTTTGTGTCTAAGAGTACCAAATGCAGAGGTCGTCCCAAGATCAGAAAGTCC
CAGAAGAAAGAAACAAAACGACAACGAATGCACAATTTGTGCAAAGAGGCCTTAATCCTTATACAAGGGACACTTGTGTCAGTGGCTACACTCTCCAGCA
TATCTAGAGTAATGAAGTCAACATTCAGTTATGAGTCTGCCCATGAGATGCTAGCTGGTTTTGAAGTCAAGATCCTCAGCTCAAGAAAGCAAGCGATCGC
CAAGTTAATTTCACCTCAAGAGTGCGCAACTGGCATAAAGTTTTCTTTCACAGAAACCTTTGTGGCTAAGTGCCGTCGACAGTTGAAAGAGTACGCAAAA
TCGCTTTCAGATTCCAAAGGAAGTGTCGACATCCGAGTGCCAAAAATTGGTGTATTTAGCAGCAATCATCTGGACATCATGGCGAAATATCATGAAGTGA
TGCGTACTATGGCAGTTGTATCGAAGACCACGGAGTGGGTAAGAGCTACATCGCTAAATCGGCTATTGATTCCGGCTGGTCTAGACGAGTACGCAGATTT
TGACAAGGATAAAGCAACTGCGGCAGTTCAGAGTTTGCAATTGACGATGAGCTAGATTTACCGTTCGTAATGACTCTGTATTACGGTTTCGAGAGGATCA
ATGGCTCAATGGCGACTGCACTATGCACGGACTTACTAATCTTCAAGAAGAATTTGGTCCAATTGGTATTATTTCCCCGGCCTTCTGCGGAATAGAAGAC
ATGACTGGAAAATACAAGATCATCGCAGGCAGCGAGCCGTTCCACAGCTAAAATCGTTTCGTGCTTCTTCCATTCCATCTTGACAAGAATCACTGGTGTG
GCGCGGTATTTGACCTTAAATCAACACCTCAAACTCTACAGTGTTTGACCCTCAGCAGCAGAAGAAGCACTATGACGAATGCGAAAGTATAATCAAAGCT
CTGTTCGAAGAGACCGCGAGCGCCATGGTCACGCAGCGAGAAGAAAACTTGAAGCAACTGGATAGTCACAGCTGCGGCCCGTTAATGCTACTTTTTTCGA
GTGCGTTGTGCGTGGAATAGCCATACCAGCCTCGCCTTCCAATGGCCTTCTACGCTACATTCGAATGCGGTGCTTACTGAAGACACTACATGTTTAGAAA
TACTTTGCAAAAAACCACTAAAAAATGACTGAGTTTTACTACCCCTTGCTTCTTTATTGTTGCTTTCACAGTGCACACAAAGAGGTCAAATTGATGCGGA
AGAGGGGACGACAGTGACGTTCATTTTCCACTACTGGCAGATCTGGTTTCCTTTCTGGTTGGGCTGCGCACGACAATGAGCGTGGTCTCAAACGTGATGG
AGCCCGTGTAGGTCGTACCCAGGCGTGTGCTGCTGGTCGTGGTGTTTACCGGCAGGGTGTAAATGGTCGTGATGACCGATAATTTGAATCAGTGGATGGT
TGGCAACATTTTCTTGATGGTTACGAGGTTGGTGAGCGCTATGGATGAATATGATAGTTTATCGGACCATACTTGAATTTTGGATGGGTATATACTGCCA
ATTACCTGCCAGAAAAAATCACCAGCCAATCACAGTTAATCTAAATCATGATTTAAACCAATCGAATGTAGTAGGTCTAGGTGAGTCATCCAAGCCACCC
GATCGGACGTATCAAGTCCGATAAAACTCTAAAATATGTGTATGTTCATTCAGTTGTCAAGTAGTAGACGTATCACTTTCATATTCCTCTTTATCGGGCC
TTCGCGATGGGTTTGGAGGAATTGCAACCTGGCAACACATTGCGGGCTAAGGCAACTGCTGTCGCAGCATTTTCCAAGTTTGTAAAGGCTGAGGATGTTG
AGGAGGAATACGTGAAGAAATGTATTGAGGAGGATGAGAGTGGCAAGAGCTTTGTGTGCGTCATGGATAAGTTTGGAATCTATCTTGCGTTTAGTGAAGG
AAAGAAGGGTAAATTGCTTGTAATGGGCTCTCCCAAGTTACATATGTAGGTAGTTTTATAGGTTCTTTGTAGTGGCTCACACCATTACATAAGTAGGTAG
ATTTGCATTACAAAAGTTGGTGCAGCAGCACACGAGTAGCGTGTGCTGAACTGCCGTCACCTTATTGGTTGAAATATGGGGAGCCAGACCCATAATCAAC
CAATAAGGAGTTGACGTGTATTTGAGTGGTCAGGGCAAGCTGCCCTGGACCTAAATAAAAACAGAGTTGGTTTTCTTTCAGACTAAGTGCTTGGTTTCAG
TATCACTGGACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACATTGCTGGCACGAAACACTGCAATGCAGTATT
ACCGCCAAGCCAAAATTTGGCTCCCTAGAGCAATTTCCCTCAGCACCGAGCTTCGCTAGAATCGCGGCTGCTTAAAATGGGAAAAACTCTAGATAACTTT
TGTCTGAAAAGAGATGGTGGTGGCTTCGTAGCAAAGGCCCCACCATGTACAAAGGCTGACTTGAAAAAAATGGTTGTGTATTTGTATGTCAATGCATGTT
CTGAGAGTGACTACCAAGATGCTGCTCTTCTGTGTCTGCTCTGGTACCTGTTCGGGCGAGCTTCGGACCTGTCGATGATCAAGAAGCGGAACATCTCTAT
AGATGCCGCCAGTGTCTTCTTCCTTCGCTTGGTCCGTGTGAAGACGTCGAAAGAACAAGGTTTGTCTCTCTTCCCCGACGCCGACTTTGCAACGTGCCCC
TTGCTCGCTGTTGCTCTCGCCCTCTCCGTCCAAGCAGCACCGTGCCCAGCTCTCATCGGGAACCTTCCCGACCAAGTGCAACAAACGCCGACAATACTAT
CACCTGACGTGCCGCTCGTGAAACTCCTGAACGCACCACCGGCGACCTCTGGTCTTGCTACGCCTGCTCCTCCTCCTCCTCGTACTGCTGCGGCCCCGAC
AATCTACGCACATGTCAACCGTGTGCTTGATCGCGTGGCCCCTGCCACCGGTGTGTCAGCTGCTCTCACGTCGCACTCATTCCGTCGTGGTGGGGCCCAA
CATGCCAACGGCTGCGAGAAGATGACCGCGCGCTGGATCTTTGATCGCGGATCTTGGAACCTAAGCACCACAAACAAAGGATTCAACTACATCTTCACCA
CAAGTAGAGAAGACCACATGATTGCCAAGGTATTGAGTGGATACAAACCAGAAGACGTTGTCCCTCTCCAAGACCTGTCCAGCTTTGACGCAGACACGCT
TGACGCGATTGCCGAGTTCCAACGAGTCTTGTTCGCAGCTTGCTACCAACTTGAGACGGAAAGCTTCAACATCAACCGGAAGGTTCTGGATGTCCTAACC
GCTTGCGTCGTTAGGCACTATCCCGTCGTAAAGGGCTTGAATCCCGACAGTCCAGCGGTGCAACGACTCGAAACCTGTGTTACGCAGGCTGGACGTACGC
TTCCGGACCTCTTAGCCTGGTCTACGCATCTTGCAGGAGCGCATCATTCCTGTAAAGACAACATAGAAGCATCCACCTCACCATCCATGCCAATGGAACC
AAGCCAAGAACAGAAGATCATCGAGCACCAGGCCACTGTCATTAAACACCTTATCGAAAATTCCAAGCGCCAAGACGCCCGCATGGATCTGCTTGAGGCA
AAGCTTAACGGTGATCCTGTAGCTGAAACGCGAAAAAGAAGCATTCAAGATGAAGACGCCACAGATGTGAGCAAACCAAGCAAAAACAGCGTAGAGGATC
AGCAACCTACCTTCATGCGACTTGGTTTACCTGGTACGCGCAAGAGCCACGCTGGTACGTCGAAGCACCGAAGCAGCAGCGCTCGAAGGCCAAGCTGCTA
GTCGCGTACATGAAGCTGTTCCTCGACGACGGCTTTGTTCTCAGCCAAACCTCTGCGGACTACCGCGACCGAGTTCTGGAACTGGGGAAGCGCGCCGAGA
ATGCCGCACTCACGTACTTGAAAGGCAAGCACAGCATCAACTCTCGCGGA