Description :
From Genome Similarity Track
Location :
Scaffold_18:3187- 5733
Transcript NameFunction/comments
Phypl_g786hypothetical protein
Phypl_g787transmembrane protein, putative

Sequence
2546 bases(100 bases per row)
CGTTGTCTAGCCCAGAAGAAGATTCCAACCCCCCCCTCGCCCACCAAAACTGCAGCTGGAAATGTGATTGCTGGCGCAGTGTTGACTGGTACCTCGGCTC
CGTCTAACCAGACGAGCTCTCCAAGATCACCTGCGTCGAAGCAACCTGCAGTTCTGACCTCGTCGAGCAAGGAGGATCAACCGACAGCATCTGAGGCCAC
GAGCGACTCCAGTCAGCCTTCGTTCCCCGTCCCGCTTGATTCAGCAGAACCTGGCGAGTTGGTACGCTCGCCAATTGCTCAAGCGAAGCGTTCGTCACCC
GATGCACAGGCTTCTGAGATTCGATCGCCAACGGAAGATACTTCTCTTGGGAGAGTCCGGAAAGCAGATGAAGCGAACTTGGATGACTCTCGCGCTGGTA
GCTTACAAAAGAAGGTCAAGCGTGATGAGATCTCGGGACGAACTGAGAGTGGACGGAAAGGGAAAGAGCCACCAGTTGGCGCGGCTACAGGTGATagcaa
ggcgaagaagaaaccTGCAGTTAACGGCGAGAGTAAGGAAGAGCGGCGGATGAAAAAATCCCTGGCGGTATTCAAGCAAGCCATCGTCCTAGGCAAAGGT
GAGGAAGCTGACAACGACTACGCTCGTCGAACCATCGCCGTTCTGGTGAATCAGAGCTCCAGATTCATCGATACGCATCTTGTTCATGTGGTACGTCTCA
TTGATATGCATGTCTTGCCGCTGATCCACGTGGATTCTCACTTCTGTGTTGTTTTGTAGACGACATTGTGTCAGGTCCTTGCCGATGCTTTTCGTGAGCT
TGAGGTCTCATCCATCACAGTTGTACGCGGGGCGCTCGGCGTCTTCCGGACCCCGAGATCGCGACGTTTGCTGCAGGAAAGCAAGCTGGGTCTGAGCTGG
CTGTGCAATCAAATGTTACTTAGACTGATGTGCCGTGGCGACGAAATCCGGAAGCAAGATGCCGCGGTTGCTTCGGATTCACTGACCTTGTCACTGGTTC
ATGACTGTTTGCAGCATCTGCGAAGCTTCCTGGTCGAGGAGCGAGCAAGTATCGGCGACTTCCTGCCAGCTAGCAAGCTACAGGTGCCGGTTGCAACGCA
GCAGATTAACGTGAGCCACGACAAAGTGTTCTTGGCGCACATTATCGCCCTCCACACACATCTGTGTCAGTCTACGGGGCAGTTGTCTCGCTcacgcgtg
ctgctgttcgacaTTGTGCGGGACAACCCAAACATCCGAGGTCTGTACTTGGCGATGGTAATGCTGGAAGTCTACCCAGCGATTTTGGAGCGTGAGttcg
accagcagctggtggagcggCACGTGATGCTAAAGGAAACCttgcagcaagcgctcgtCGTTATAtcgggcgctgctgccttgaGAGAAGAGCTCCTTCT
GCACCAGTCGAGTATCACGATGCTTCATCGCATCGCCGATGCCATCCAGATGcccgagctggaagaagtcgatGGCACTAACCCCGACTTACCCAGGACG
tgcgtggagaagctgttcaGCAAGTTGAGCCCGGAAGACGCTTCACCAGCAGTTTACTTCGAGCTTGCCAAGTGTCTGGAGGTGTGTACGGCAGTTTACG
GCCTCGACCTCGTGACCGAAACCTTCAGCATCGAACGGTGCCAAGATCTGTTTAACAAGGCGGACGTCGAAGCCAAGAGCGGCATCCTGTCGATCGTCGG
CCATATCGCAATGGCCATTACGCCGAAGACGAGTGATACGCAGAATCCCAGGACCCGAGGCGAGCAGTACGTGGAGAGCGTCGTCGACtggctgcaccag
ctcctaGCGGCCAAAACGACTGACGACAAAACTTCAGCGGAAGATCGTTTCAAGCTGTGCGTCAGGTGCTCGACGGTGTGCGTCGAGTTGATCCTGGACT
ACTCGGCACCGGCAGCGCTGGACGTCCGACGTCGGGTGCTATGTGAGATTGTGAACTGGTTCGACGCAACGCCGCCAGACCAGCTTCTCGGCTTGCCTGC
AACATTCTTGAGGCGACTTCGTCTTGCTGTGGtagcagctcgtcctcagGTGGTACCTGCTGCAGTCTAAGCAAGCGAGACGTGACGATAGATTTGGCAT
CGGTTGTGAAACGGACCCCTTTCAGCTACCTCGACTGCAATGCTTCAACCGGAACACTGCAATGTCGATATGGTTGTCGTCCCCTGTTGTGATGGCGCAG
AGTTCTTTCGTATCCACCGACTGTAACCACCCTGCCGGAGCAAGCCATTTTCGTAACGACCCGGTGTTGGCTGTGTCCCTCCGTGGCAAAAACGTTGCCA
CATTCATCAAGAATCGCAGGAGGGCTCTGCTCTGGTGTAAGATAGTTTAGTGTGAGCTGAACTAGTGACTGAGAAGGTTGAGATGGCTGAGCCGACGGAG
GTTCCAATGGATCCCCCGGACTTGGAGCAACAGTCCGGTGTGGCCGCGGCGAATGAAGAgccagcttcaacagctGAAGTAGAGACCGACGAAGTGGCAG
AACTCAACGAGGAGCAGATTTCTGAAGTCGAACAGCAAGCTGATGT