Description :
From Genome Similarity Track
Location :
Scaffold_6:3186977- 3197651
Transcript NameFunction/comments
Phyin_T30-4PITG_04820Putative uncharacterized protein
Phyin_T30-4PITG_04821Putative uncharacterized protein
Phyin_T30-4PITG_04822Inositol polyphosphate multikinase%2C putative
Phyin_T30-4PITG_04823Putative uncharacterized protein
Phyin_T30-4PITG_04824Putative uncharacterized protein

Sequence
10674 bases(100 bases per row)
CATAAGGTGGGCCTTGGTTCTTCGAGTTCCCCATTTGCGCGACCACCCAAATGACCTTCCAGCAGAAAAGCTGCTGGGAGTCAAATTGCTGTGCACGTAC
AGGACGCGCTACATTTACTACTGCAATGATCCTGAGAGCAGCAGCGCCGCCGCAAAGATGGGGTGGTCTACGTCGGTTGAGCGGCAAGGAGTCACATGCA
AGGTGGCCGCGGCACGAATTATAGTAGTGATACACATGCTATCAGTACGCCGAGTCGTAAAGAACCTACCGCACACGAAGTTCATGTTTATGATGAGCTT
CTTGGTGAAGCTTCATACCGGTAGATGTACTTTAAAGTAAACTGTACAGTTACAGTGACTGAGTCAGTCCGCCCCGCCCGGTGCTTTCTGCACGCCAAGC
CCTTCTCTTGCATTTCGGAGCTCGTCGTCACCAAGATAATGGTGCGCTATAAATGTACTGTAACCAGCAAAAAGGCATTTGTCAAGCATGGCACCATTAC
GATGTAATTTTATCTGGCAGCGACCGCCATCGGCAATGCACGTACGGATCAGCGGATCCCGCGCGCGAATCCTACGAGCTGGCGGCGTCACCACAATGTA
GCATACTGTGGTCCACAGCATTGTCGGGCTTATGACATCGATCCTGCTTTGCAATCGTCCGTGAAACCAGTTGCCATTGGCATAGGCCAGGCGCTCTGCG
ATACGCTAAGAGCCGGGCTCCGATACGAAGTCACCTCATCTCGAACAGGATCAAGCAAGACGAACTGCCGTCTTGTGCAGTTGTTGCCCCGTTACTTCAT
ATTACTTCATAGTAAGGCGGTGATGACACGAAGGACTTCGGCGTTTTAGCCACATCCGCTCACGGCCACCAGGCGGATGCAATAGCGGCAGCAAAACTCC
ACCAGGGCTTACTCCTCGCCGCCTCTCGCACGCTTCGCACTAATGAAACGCGGCCCGTTCGTGTACGGTGTTAATCCCGCCGCCGCGGTTTCGTAAAGCC
ATCGCTCTTTTGGCTCTTCTCTAGGTCGGCGCACATGCACTTCTGAAGTGTAAGGCCGAGCCCAGGGCGCGCGACCGCCGGTCGCCAACCTCTCCACTTG
AGAATGAAATTTCAAGTCCACATGTACCGGTACGCTAAACGAAAGGACTGGCCATGGCCCGCCGCCGGTTGGGCCTTGTCGAATTGGCACGGCAGTAGGC
GAGAAGGTCCACGCGAAAAGTACTTGTAAACAGTATTGACCATTATGCACTTTCGACAGCATGAACTGCAATATCGGTATACACTGCAAACTCTGTAAGA
AATCCACTTGCAGGTACATGTATACATGTACTGCCGACGGCGTACTGAGCGGCAGTCTGCTGTACAGTAGATGTAGCTTTACCGTAGCTGCAGGAGTCCT
ACCAAGTTTGGACGTCCTGCCAGGACGTCCAAACTTAGAAATAATACATGTAGTAGAAAGAAGGTTTTCACATCGCGAAGGAGTTGCTGCTGTTCTCGCG
GAGCTCACATACAGTTTGCTGCATTTTGGCCAATTTTTGAATTCGGCCAATCAGCGCCGGGCCCGCAGAAGTCCGATTTGCGCGCGGATTGGTTGAGCCC
CGCTGCTCTCTTGTCGAGGATGGGCTGGGACACGTAAAGGGATCTGAAACTGTCGTGCCTTTGCGTCGTTGGCCGTAATTGGAAGGCCACTTCTCGGCCA
GATGAACGAAGTGGCTTCGCTAGGTTGATTCAAAGTAGGCAACGAGCGAGATCGCCGAAGCTATCTTTGGGGAGGTCGCTTAGCAGCCTGCAACGATCTA
TTTCTGCCTTCGGTCAAGCGAACCGCCATATCTGTCTCAAGAGAAAAGCCAGCGTTTTTGGTGTATCGACACACAATCAGACGCAAACTGCTCCCCTAGC
CGCCGCGGCGCGGCTGCCCCCCGGCCAGGAGTGAGTGGTCGTCCTGCGCTTATTACCATTCCTACCAGGCCGTTGGTACTCCACTCGCCTCGCTCGTCTT
CGTCTCGCGGTGCCCGTCTCCGAGTCTGCAAGTATTTTTTCTGCTGGAGCAGGGGCAGTTAGTTTTATGGCCCCCACGTCCACGTCCTCGGCGACCCAGT
CCTCGTCCACCATGCAGCCGCAAGATCCCAGCTCCGCCACGCTCGACGCCTCCCAGGCCTTCAATTACGACCCGGCTTCCTACCAGCAGTACGCCCAGGA
GCGCGCGCTTCACGACCAGGCCGTGCACAACTCTATGGCTGCCGTTAGTGGTACGGCTTTAGCCGGCAAGCCCGTGACCAGCTCGGTCCCCACCTCGGAC
AAGGACTCGTCCAACCTGCGCCTCAAGACCGAGGCCACATCGGCTAGTACGTCCCCCACCAGCGTCGCCAAGGTCCAGACCCAGACGTCCACAGCACCTA
CGCCAGCCTCCTCGTCCTCTTTAACGGCGGCTAAGACTAACGGGGCCGCTCCAGCCCGCAACGAGTCTCTCAAATCAAACCGCCTCTGCACCATGCCCGG
CTGTACCAAGCGTGTGCGCTCCAAGGGCCTATGCAAAGCGCACGGCGGTGGCCGCCGCTGTATGGTCGACGGCTGCGAGCGTAGCAGTCAGGGCCAGGGT
CTCTGCATTCGCCACGGCGGTGGCAAGCGCTGCACGCAGCCTGGCTGTACCAAGGCGTCCCAGTCCAACGGTCTTTGCAAGGCCCACGGCGGTGGCCTGC
GTTGCCAAAGCCCTGGATGCACAAAAAGTTCTCAGGGTGGCGGCTTCTGTCGTGCTCATGGCGGTGGCCAGCGCTGCGAGAAGGAAGGATGCAACAAAGG
TGCTCAGCGCGGCGGCTTCTGCGCTGGTCACGGCGGAAGTCGCTTCTGCCAGCACCCTGACTGCACCAAGAACGACCGTGGCGGAGGCTTCTGCGCCGAG
CACGGCGGCGGCAAACGATGCGACCACCCTGCATGCAACAAGCCAGCACGTAAGAAAGGCAAGTGCTCGTATCACGCCAACGCCGCCAAGGGCAAGCTCC
CCAAGGACCAGCTTGCTACGGCTGCTTCGCTGCCGCAGCACATGATGGATATGCGACAGATTACCACGCCGACGTTCGCGATGGGTGTCAAGGATTTGCG
CGACGCGCACCTCGACCCACAGCGCGCTGCGTACGTGCAGCAGCGCGTGGAGATGGAAATGCGCTACAAGGGCTACGAGCCTACCGCTAATGGCCAGTAC
CTGCAGATTCACGCCGACCAGCGTTCGTATGAGCCGATCAGTCTGCAGGCTGGGGCCGCTGCTCGTTACCACGTGCCTGTGGACAACGGTGCGTTGCCTC
CGGTGTCGGGTAGTATGTACAAGCCTGGAGCCGCGGTGGACCGTCAGGCTTACGCCTCGCGCACTGCCCCCGAGCAGATGAAGAACCCGTACTCGCAACA
CTGGGCCACCAAGCCGGAGATGCCCCAACATCACCCGGACGGAAGGGTCGACTATTTCGATGTGAACAAGGAACAACAACAGCAACAGCAGCCTGGCCAC
CACCACCCGTACCCTGCCCAGTCGTCACAGTACCACCACCATCTTAGTCCTGCAGACTCGGCCGCCGCCGCTGCGGCCTACGGTCAACAAGCAGGCCGTG
GATACTACAGTCCGCAGCCCCCGCAAGCTTCTGGATCTGGAGACCAGCCTTCGTCCCAACAGCAGCAGAGCATGATGTATTACTCAGCTAACGGGTACCC
CCCGCATCAGATGCACAACATTCAGCAACAACAGCAACAACAACAGCAACAGCAGATGCAGATGTTATAAGCCCAGCAGTGCCAAGTGCGGTCGCCGAAT
GAGTCTGCTTTCCTTGCACGTCGCACAATTATGAGACGAAGCTGACGAGACCGAGTGCAAGCGAGCGACGTAGTGAGCCGACCGCGCTGCTGTAATAGAG
ATAGAAACAACCCACCATGGATCGGAGCTCCTCGTCCTCGAGGAATGCCGCAGCAACGTGTTTGATGCCGTCGGCTTGGGTAACGTAACCTTCCTCCCAA
CCAGTTTTGATCAAGCCATAAAAAAGGAAGGATTGACGCACAAAACCAGTATCCGCATTAATAAGTTGAGAGCTTGCTTTTTTGAAATTCTTGAAGTTGC
CTTTTGTTGTCTATGAGTGATTGTTGCCTCAGCCCTTGTACAGCGGCACCACCAACATCTTGGTTGCCCCTGTTGTGCAAAAGTCGGCAACCAGCACCAA
CTCGCCCTTCTCTTGCTTGTACAAGCCCAGACACTTTCGGTGCGAGTCAAGTGCCTCGACGGGGCAGCGCCAAAGGCCGCAGAGAAAGCATTAAAGATCA
ACGTGTTACAGTTTATCGAGCTAGTTCACCTACACTGCTCTCATAATTGTCCGGGGCGGATATCCTATGAGCTGACGTCTGTCGTCGTGAAAGCAATCCA
GTCTCGTCTTCGTCTCCGTTTCGCAAACTAGCAGTGAAGCTGATGGCTCGTCGTCGCGGCATGACAGCTGCGAAGTGTCTTCTATTAGGACTCTCGGCTG
CGGTGGGGCCGCGCACATCTTCAAGCTTGGCGTTGCGGGCAGCGCCGCCCCGTCTCGACTGCAGTTTGGCCTGAAGATAGGTACCGATGGCGGACGTGGG
CAGATGCAGCGGCCCAGCGCGCGGCGAGCCGGTGACGTCCTGGTTATCGTCCAGGGCGACGCGGAAGCTGCCTTTGCCGGCGTAATAGTGTCGATAGCAC
TCAATAAGCTCGTGTTCCATACCCGCGTACGTCTCCAGCAGTTGCGCGGCGGACGCCTCGTTGCCGGGCTCGTAGACGTGCAGTAGATGTTCCAACTCCG
TCCTGTAGTCAGCCGCGTCCCGCTGGTTCTCCGCTTGGACTGTGCTCTGCGGACGCATGGGATGAAGCTGCTGTCGAGATCTCGAAGAAGCCTAAATGGA
CGCCGTTACTGGGGCAAGCTCTCTTGGTGTGCAATTCTATATTATACGTTTCTTTTTTTTCGAAACGGTTTTTTTCCATCGACTTTACAGCTTCAACTAG
ACCATGCTGAAAGTCTCTGTCTGAAGATGTGAAACCATCGATACAAGTAGCGCATGGTGCAGTCTTACACAGAGATTTTCATGCTGTTGGACGACTTTTA
ACAGACCCGCAGATGACTCTGGGTTCGTTTGTAATTTGTGAAGCAATCTTTCTAGGTTTGTGCTTGGTTTAGAAGGGTCTGGAAACAACTGATCAAAGTG
GCAATACCCGTTCGTAGTCCTTCGTCGTGCTTAGGAGAAGTTGGTTTCGTTACGTGGGCAAAGTCGATGAGGCGGATTTCGGCTCCAAAGTCCTCTGCCG
CGGTTTTGTCGTCGTTGGGTGACTCCTCGCCGTCGTAGAGGAAGAGGAAGGAACTGGCGATGAACTCGGTCCCTCGCTGCTCATCGAACCACGCCTTCAA
CTGGCCAAGGCGACGCAAGAACTGAGTCGACAGAATAGAGAGTAACAAATAAGAAAAAGAGAGCGTCATAGCCGAATATTCACAGTAAACTCACCGCCTC
CAACAACTTTATGGTCTTGGCATCCTCCGCTGGAAAATAGCTACGGAAAGCTGGAGCGAGCTGACCCACCGACGAGATACCGCGACCAAAATGCTTGTCG
AACTCATCGTAGCCCTTCTTCTTGGGGTTAAATACTTTGATGCCCTGGATACGGAACCCCACCGTCTCCTGCAAAAGGAACTTGGATTTCTCGTACGCGA
TCTTCTCGGATGTCGCATTGTCTTCGTAAGATCTGGTCCCCATCTTGACATCCATGATGCAAGGCCACTTTCTTCCCCACGTTAGATCCTCCAGAATCAA
ATACTCTGCGCACAGCAATGATCGCTGAGTCATTAATAGTCGTCTTCAACTCGAAATCGACAGATCTACTTACGTCCCGGGTGCACACCATTGGTCTCCT
GGCCGTCCTCGGGTTCGGGAACGATTACTGTGCCGTAGTACTTCGGCAGGAACTTACTTAATGCTGCAAACTCGAGCGAATCCTTCTCAGTCGCGAACAC
GCGTTCGTAGAACTCGCGCTCACGTTCTCCCCTTTGCTTACTCTGGAAAGGTTTCAAGATGCGGCCATTGTAGGCCTTCAGACCTGCCAATCACGGTAAT
AATTGCACGATTAAGACCGGCGCTAGCCGATATATAAGAGAAGCCGTGGTAGACATCATTACTCGTTTTGGCTGTAGCGTGGCCGCCCACTTGGTGCGCC
ATCTCCGTGAAGCCCTGCACAGCCGCCATCTTCAAATGGTTAGTGACGAAATCTGAAATAATCTGGATTTTACAAGTTTCCTTCCTAACAGTAGAATCCT
TTTTTTCGACTAACTATCTGGTTTTTACAGTTAATACGGAGTCGGAGGAACCTTTATCACGATGGTGCATAAATTGCAATTCTTGAATCTCTGCATTTAA
AAGTTTCATTTGGAAACAGTCAATTACTAAGAATTATTAATAAAAACAGTTTAAAGGCCCTGATTTCTCCGTCGAATTGTTGCCCAGTTGCTGAAAACTG
ATTTGTGACGAAATCTGGATTAGTCTAGAAATTAGTCTGGATCAAATGCAATTTGCATGATGCAAATTGCATCTGACAATGAAGACGCGGGTGTTAGTGC
TCGGTGGAACGAGCTACGTGGCGCAGTTCGTACTGCAGCGCTTGCAGCAGTACGCAACACTTCGAGTGGTGGATGAGGATACAGTGAAGGAGGTTGAGGC
TGTGGCGTGCACTACTCGCAGCCAGCCATTTGCACCCCTCCCAGCAGGGTTCATCACGGCGAACTCTGATTCCTTTTCCGAGTCGAAGCAAACTGTGACT
GTTTACTGGCAAGTAGACTTGATGGATCTAGAAGCGTTAAATAAATGCATCGACGACTTCCGTCCGACGGTGGTTATCAATTGCACGGGTAGAAATTGTT
ATCATGTTGAGGTAGGAACTAGAAATTGACAATAGCTGCTGATTTTTTTTAATGTTGCGCAGCGATTTCGTCGCCTGCAGTTTGTCAGAAGGAACCTGAG
AGGGCAAGCGCAGTCAACGAGGAGCAAAACACTTGTTAAGAATGTTGGAGTTTGTGTCCGTCCTATAATCATTTTGCGCTGAATCCTTTGTCTACAGCCT
CGAGGTTTGGTGGCCTTGTTGGACGAGCTGCCATGGCCCATTAGATTTGTGCATTTGTCGACGGATTTTGTCTACGAAGGAACTAAACCCCAGGGAACGA
GCTACAAAGAAGACGATGCAGTCTCATCGCCGGACCTGTCGGTGTATGGAGTGGGCAAGCTGCGCTTTGATCATTTCCTGCAAAATCGCCCTAACTCAAC
AAACTTGCAAGCTCTAATTCTTCGCATTGCCAACGTCGTTGGACCGACAGCTCCGCTGTTTCCCGACAGAAGTGCACCGAAGTTCATGGAATGGCTTCAC
CACCAATTATTCCAGCTCGAGACTGCTACACCACTGAAACTCTGGAGTGACGAGTTCCGTTCGTACCTCTACGTCTTCGACTTGGTCGATCTATTGATTG
AGCTGCTAACGATCAATTTAAAAGAACACACTACTCTTGTCAACGTCGGTACGTCAGCAACAAGTGTACCGAACGTGGATCAATCAATACTAATACTCTT
ACTGACTATAGGAGGCATTGATGCACTCTCGCGCGTGGAACTTGCAAACAAGTATCTTGCTGTCACTGCAACGCACAACCCGACTGCAATTACTGCGATA
TCTAGACACATTGCGCCGACATCACGAGCTCAAGTTGACTTGGGGTACCCATCCCCGCTCAACACGAAGCTCAACACTTTGCGTCTGGCAAATTTGTTGC
CACACTTTATTTGGACACCGACCGAAAAATTTCTACACGAGATCAGTTGCAGATTTTTCATTAAAGAATAATGCGTTTTTTAATCAGATTTTTTTGCAGT
TTGTTAACTTGGGATAAGAAAAAAATGGGCAAGAGCGATGATCGTCAACTTACACAACAAAGCGCGCCCCCTTCGCGTGTATGAAAGAAACAACTCTCTC
CAGTTACTGGATCTCCATCAAGTTGCCCATGCTCTTGCGACCTTCCTCGAAGGCTTGCACAATAGGATCTTCCCCACGACTGCCGGAGAAGACAAAGTCT
GCGTCGCACAGAGCGATGGAGTGGCACGCTTGGCTTGGACTTTTTCCTTCGCGCATGAGCGACACCAACTCGTCGAACTTGGAAGAAAGCGCATCGCAAC
GAGCACGCGGAGGCAGCACCGTGCACATGGTCTCCAGTGTCATCTTGGCCTCCCTTAGGGCCTTGTCATTGTTCTTGGCGTACTCCAAGAGGTCGGCAGT
GTACTCACAGAACAGACAGCCCACAGACATGGACTTCTGCTCCGGCACTTCGGCCACAGCCGCAGATTCACACTCAGCAATACGCGTGCAGATGGTATCC
ACATCTTCGTTCTTCTTGAGCGAATCAATGATCGCGTCTTGGTGTTTCATAAGCAGCTCGCACTGTTACATTTAATTCAAACAAAAGTCGTTAGCTTCAT
GTTATTCTTAAGACAAGAGAGGCTGCACTTTTACCTCGCTGGACTCGGGGATCAATCGGCAAATCGAGTTGATCCCACGCTCGAACGTCGCTAAGCCGTC
CGGCCGCGTGATCAAAGAGGCCAGTAAAAGTGTGTTTTGTTGGCAAGTCGTGCATCTTGAAGGCTTGAAGTCCGATCCAGTGAAGTCAAGCAGACCCGAC
ACCAACTCGTTGGAATTCTCCATGGCAGAGCAGAACTTTAGCGTCTGGCAGATTTCTTGAGGCTCTTTTCCGGCGTGTAGATCAGTCACAGCTTCATCAA
ACATCTTGAGATCGTCGTGGCACTAGCACACAACTCAAAACTGTAAGGTTTAAACCATCAAAGAGAGTCAAATATTGCCCTGCGTACCGTGTCGTCAGCA
GGAAGCAGATGACACACGATGCCTGCAGCTTCACGCATCTCCTTGACTTGCTCCGGCTTCTGAGCGAGCGCAAACTTAAGCACAGTAACCACACCGCTGC
AGTACGCGCACGTGTTGCCTCCCTCGTTATTCTGAACAGCGATCACTTCGGGGACAGTAAGCTTAGCCATAGCAGGGTTGGTGTCCACCTTACAATACTG
CAGGTCATGACAAATAGCCTTCGGCTGCTCGCCCTTTTGGAGAGAGTCAACCACCGTGTCGAGTTGCTTCACGAATGCGTGACACTACAACATCACAAAC
AAACATTAGCCATTGGAGATAAGAGCCCGCGTCCAAAGACTCCTCATACCTGGTTGTCGCTCGGGAGCATTCCACAAACGACGTCGGCAATCTGTCGAAT
CTCCTCGATCTTACTTGGATCTTGAGCCACAGCCACCTCGATGACAGACGCCACTTGCGTGCAGAAGAAGCATCCATTAACTGACAGCGTCATGGAATCC
TGCACCAATTGCACCAGCACCGGGTCGTAGAACGACAGCTCGTTGCTGGGAGACGGTAGCGCCGCGGCCGTGCAGAACTTCAGCTCTAGACAAATCGCCT
TGGCACTCATACCCTTGGTGATCGCATCAATGACAAAGTCGAACTGCTTCACGTACACATGGCACGGGTTTTCGGCGCCCAGCATATCACAGATCATGTC
AGCGTATGCACGGACTTGACGGATGTCAGTGCCGTACTGTTGGAGCGCAATCTTGGCAACTGTGGTAGCGAATTGGCAGTACGTGCACTGAGTCGCATTT
CCAGGAGGCCACTGAGACGCCACCACCACGCCCTTCATCTCGTCAGCGATGGAAGGTTCGTCTTCCTCCGCGTCTTGCGCCTTCTTGCAGACACCGAGAG
ACTTGCAGATCTCGTGAGGACGCTTGCCTTCCTTCTCCATTTCCACAATTTTGTCGAAATTCTTGTCCACAACGTCGCATTTGAGCTTTGCAGGCACCAA
TTGGCATACATTCGACAGGATGTTCTTCACAATCGGCAACTTCTCTGGCGACGTGTGGTTGACGTGATGGATCACCACAGCCACACGCGAACAGAAGAAG
CAACTGCCATGACGACAGTGAAGAGGACGCGGCGAGTGCTCGTCATCTTCCGCCATCGTTGCGTGGTTATGACGCCCATGACGACCTCCAGGCCCCACCA
TCCCCACGTGGTGGTGCATACCACGAGGGCCGTTTCGCATCATACCAACACGAGGGTTCTCGAGTTCACCGAGACTGTTTACGGGTTCCGTGATGCAGTA
CTTCAGCGCCTTGCAGATGTCACGAGGGTGCACACCCTTCTTCAGAGAATCGACCACAGTGTCCAATTGGTCCACATACAAGTGGCATGGACTGTCGTCT
CCCAACATGCCGCAAATCATGTCAGCGTAGTCGCGGATCTGGTCAATCTGCTCAGGAGATTCTTGCAACATGACCTCGACGATAGTGGTGGCTACGTCGC
AATACACACACGTCTTGTCCCCATTTAACGGTGAAGTATCACGCACAGGCTTCACAGCGCAGAAACCAGTGTCCCCACAGATCTCTTGAGGGTGTTGGCC
TTGCTGGACCAGCTCCATGATGCTGTCAAAGTTGGTTTCCACCTCCTTGCACTTGGATTCCAGTGAAGCCATCTCGCATACCGCTCCTAACACAGACTTA
AACATTGGAAGCTGTTGAGGGATCAGTTCATTGACTTGGTAAATGACGCCGGCCACGTGGCTGCAGAAGAAACA