Description :
From Genome Similarity Track
Location :
Scaffold_14:318656- 323046
Transcript NameFunction/comments
Hyaar_Emoy28026365'AMPactivated protein kinase subunit beta putative
Hyaar_Emoy2802637hypothetical protein
Hyaar_Emoy2802638PREDICTED: uncharacterized protein LOC100202525

Sequence
4390 bases(100 bases per row)
CCGGAAGAGAAGGGTACACGCACCGAAAGCAGTTCAAGCAGCCCACCCGTCCACACTAACCGCCTCCTACGACCGCTCGTGCTGCTTTCTCCATCTAACC
AAGGGGGTGAGGTCTCCCATTAGAACTAGCAGAAGAAGTAGCAGCAGCAGCAAGCGCAACTCAAGCGACGCCATGGGCAGCGCCAGCAGCAAAACGGACG
ACGTCGACCCGAAACATTTGGGCGCAGACCCAAACGATCCCCACGCGTTTTCGCTGCACCAACACCCGTATTATAACCAATCAGGGCACGACAAGACACC
ACCGCAGAATCAGAATCAGGACGACGGCAGCTTGGACGATGCTCGAGACGGCAAGCAGCAGCAGCAGCAACAACAACAACAGCAACAGTACTATGCAGAC
CAGCACAATACCTCGGAAGCTATGGACGTGGACCCACCTAGTACTTCATTGGTGGACAATTCGTACTTAAACGGAGACGTCGTCCCTGGTCCAGCCCAGC
TGGATGTGATAGCTGAGCTAAACGGGGGAGACCATGCAGACGCTGCTCACGTTGCAATGGCGCCTCGAGAAGATGTGGTGCCCATGGTGTTTAAATGGGA
GCACGGTGGACGGAATGTGTTTATTACCGGCACATTCAATGGTTGGGACAAGCAGTGCCCGATGCATCGCTCCGGCAATGACTTTACGTACATTGCGAAT
CTTACACGGGGGAAGCACATGTACAAGTTTGTGGTGGACGATGACTGGCGGTTTGCGCCTGATCAGCTCACGATGGCAGATGTTGAAGGCAATGTGAACA
ATTACGTGGACGTGTCGGAGTTTGCCCCGCTGTCGGACTTTGACGGGAAGAACAAGTCACTGGATGACGACGACGATGATGCGGAGAATCCGTACTCGCG
GTACATTCCCGAGATTGACGAGTACACGAAGGAACCACCGCCACTTCCGCCGCATTTACGGCACATCATACTGAACAAGGTACGTCGGTATATGTAGGTG
GCGTGTACAGATTGTTGTGCGGATCTTGACTCGTGTGTGTTGTATGCCTTGCGTGGGGATTCATTGCAATTTAGGCACCGCCTACAGTCGATGGACGATT
GCTGCCTGTGCCGCAGCACGTGGCGCTGAATCACCTCTATTGTACGGCAATCAAGGACGGCATGATGGTGCTTGGCATCACCAATCGCTATAAGCAAAAG
TTCGTGACTACCGTTTATTATAGCCTCATGCCTGGCGCCAACTAGATCTTGTCACAAGAGGCTCGTTGTGTAGGCTGACGGCAGCGGTGTCAAGGCTCAT
TCTCATGATCGGACATACTGTAGAAGACAGCACGGGAGGAAAGTGGAGCCAAGTCGTGAATGATCCAAGTGTTGGACGCGGCGTAGACATGCAGTGCGCA
TGCGTTGCTTCGCTTCTGTAGGAAGTAGTAGACGGCAGTTTTGTTGTGGCAAGGAGCTGCTTGCAGTAGGGATAGCGAGTATTGCCAAAATGGCAGGGCA
TGACCAACCTAGGAACGGCAAAGCCTACAGCAATGGGAAGCAGGCACCGTTCAGCCATTGGCACCACCAACACGCTCACTTCCACGCATGTAAACACACA
GCGGCAATTTCAAGCAGCCACGAAAGAAACAAACGGTATTTTTCACTCTCCAACAGCAGCACTCGTTCCACCAGGTCCACGTCAAATTGAACGACCAGGT
CCTGCAATTTCTAGGTTGTCTACCACCTTCTTCTCCTTCGTCTCCATCATCATCATCACGACCACACACTCTTCTCCTCTGCTCTCCGTCTTCTATCACT
AGAGTGATCTAGAGGCCTACTGAGGACTTTTAGCCACGTACCAGCTGCAGAGCTGCAACTGAAGGCTCGTTGGCTACATGTCTATACGTAGATCTCGGCC
CACAAGAAGAGGAAGAGCGTGCCAAAGCCCAGCAACAATGCTCCAATCAAAGAAAGCACCAGCTCCACAAGAGCGTTCTTCTTAGGGGTCACAGCACGTG
TAAAAAAGAGTGCCATGAACACGAGTCCAGTGAGCAATAGCGCGACGGTGAGGAAACCGTATCGTTGGGGGTCCACAGGACTCGTGTACGGGATTTGCTA
CAGCATTGAAAGACATATAGAGAGAAAGAGAGAGAGCATAAGAGCGCGGGTTAGAAGCAGTAAACGGATTATACAAAGCGGTTGGGCACGTACGATTTCC
ATCGGGAATCTCTTTTTAGTGACTGACACGGAGTTGACACGTAGTGAGAGTGGTGCACACGTAGTTGGCGTGGTTGACACGAATCCACGGTCTCTGACCT
ATTTCAGTGACGACGTCGGTGGTAGTTAACATGGCGACTTTAACGAAAAATACACACATCAACTGTATGCAGCTCACCGGCTGATGGGGCAGCGAAATCC
TGTGGTAGTATGTTTGATTGCTAACATAAATACGAAACTTACTTGGATCCGTCTTCATCTTGCATCGCTTGCTTGAGTCGCTGCACGAGTTTTGCCTTGA
ACCCCTTCGTGTCAAGTCCTCGTTCCTTCAGCTTCGCTCGCAGCTCGACTACCTTCAGCTTATCGACATTGATGGTCGCACCAGACTCGTCGCCGTCAGC
TGTCTTTTCAACGATGTCAGATCCGCCTGCCGACATTGCTTCCTCGACATTTGCAGGCGCGGCTTTCTCGACGTTTACGGGTGCAGCTTCCTCGTCGTTT
GCGGGTTCTCCATCCTCGTCATTTGCGGGTGCAGCATCCTCGTCGTTTGCGGGTTCTGCGTCACCAACATTTGTCGCTGCTGCTGCCTCATCACTTGTAG
CTGCTGCTTCCTCGACATTTGCAGGTTCGGCCTCCTCACCCTTTGCAGGATATGCTTCCTTGCTTTTCTTGGTGACAGCAGCTTGGACAGGTTCATCCGG
CTTCTGCTTCGGGCTCTCTTGTGCAAGACCGGGTGCCTTCGCTTCCTCGTTCACGCGACTAGCGGATGAAGCCTCTGTATCGCTGTGATCCACAACTGGA
CCAACCGTAGCTGCCTGAGGTGAAACCGACTGCCCTTTTCCGTCGCGCTTCTGTGAGGACTCTGATCTTACCGGAGACCTGCGAACGCCCTCTTCAGCAG
CCCTCGCTGGCTCTGCTGAATCACCTGCTTCATCGTCAGATACACGTTGCTGGGCGATATCGCTGTTCTCGACTTCCATCGTCGGAGACCTATCACCGTG
CTCGCTTGCCATTTCCACATCCTCATCGGGCTCTCCAGAACCTTTGATCATATCCAGGTCACCTTCGTCCATTGAATCCTCCGCCTTCTCGCTCGTTGCA
TGCCTGTCAGTGGTCTCCTCCACTCTATCCTTCTTGACAGCTTTCAGATCTTCACGAAGCTGCTTCAACTTGGTCGCGAACTCAGCTTCCAATTTCCTCA
GATTCTCCTCGTGACTCTGTTCACTGGCTTTTATCTTTGCTTCATGAGCCTCCATGGACGCAGCCACGAGCTCTTTCGTCTCTTCAGTGTGCTTTGCTGG
AAGATAATTGATAGGGGGCGATGCAATCGTGACCAGAAACTTGGATTGACTTTCGCTCCTTCGAACCATTCGTAAATGCTCCAACTTGGCACGTGCAATC
TGCTCGCTCCGATCAAGTTCAGTGCGCGCGACCAACGCCTCAAGCCGCACGATCTCTGCCTCTCGACGAGCTTGTTCTTCCAGATTCTTGCTCTGCGCCT
TCTCTTTTTCCTCGGCCTCGTGCTGCTTCGTGTCTTGACGTTTAAACAAGTCCGTGTCCTTCTCAATCTGCCGCTTCGCTTTGCCCAAGTGACCCATCAG
CGCACCAAACATGCGGCGACTGCGTGCAATACCGTCCTTTTGCGTATACGGAGCTACCGCACGTTGCTTCTGCTCCTGTGCACGAGCAAGGTCTACCACC
GGTGACGTAGCACCCCTGCTAGTCTCTTCCACTCTCACCACCGAGTGGCAAACTCCTTCCGGTCTTGCTACAGCTGAGTTCAACTTCTGTTTCTTCACTG
CATTGCTCGGTGATCGCGCATCGTCGTCATGATCACGCTTTCCCAGTCTCCACGGAGCGTTACCCCGCGAATCGTTCCTATCCGTACGCTCAAGGGCCTG
TCTAGCTCCACGAGTGACCTTCCCTCCCAGACGTGCAAACACGCTGCCTCGAGGTGAAGCTCCTCTTCCAGCTCCTCTTGTCTTCCCGCCTTGACGTTCT
GTACGTTATAAGGAACACATTGTAAAGGAGCAATTAGCACTTAGATCTAACGCCCACGCGTCCAGAGAGTCAGCAAATAAAGAGCAGAACGCACTCAAGT
TGACGAGAGCCTCGCGCTGTTTCGCAAGCGCTTGCAGCTCGCGACGCAGCGCGCGTTCGTCCGCTGACTCGGCTTGATCGGCCATCGCTG