Description :
From Genome Similarity Track
Location :
Scaffold_18:31864- 37557
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.26O-phosphoseryl-tRNA(Sec) selenium transferase
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.37Eukaryotic translation initiation factor 3 subunit

Sequence
5693 bases(100 bases per row)
GATGAATGCCCGCAATGCCGAGCTCGCGGCGGCGCTCGTGCCGGCCGGGTACGTGCAGCAGGGCGTCGACGCGATCCGCAACCGAGAGGCCCTGTTGACC
ACGCTGCTCTCGCAGCGCCGCGTGCCCGACGAGCCGTGGGACGAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGCAGCAGCTCGCGGCCATGG
ACAGCAACAACTTCCGCACCAACATTGGCGCCGGCGAGCGCGAGGCCCGTGTCTTCTCGTCGCTCGTGGCTCAGCGCCATTTTTTCCTCTGCCACGGAGT
CGGTCGCTCCGGTGACGTCGCGGCCGTGCAGCCCAAGGCCGCCGGCTCGTCGTTGCTTGTGCAGCTCAGCAACGCGCTCGCGCGGGACATTTTACGGGAC
GCTGGGCTGCGCCTCACAGCGGCCGCGGTCGTGCTACCCGTGGCCACGGGCATGTCGCTCACACTCGTACTACTGGCGCTCAAGACTCGAAAGCCAGAGG
CGACGTACGTCATCTGGCCGCGGATCGACCAAAAGTCGTGCCTCAAGTCGATCCTCTCGGCCGGGCTCACACCGCTGGTCGTCGAGAATGTGCTCGAAGA
GAGCGGCCAGCTACGCACCGACGTGGACGCCGTCCAGCAGCTATTTGACCAGCACGGCAGCGCAAGCGTGCTGGCAGTCATGACCACGACGAGCTGCTTT
GCGCCGCGCGGCATGGACCGGCTCGTCGAGATCGCGACGCTCTGTCGCGACTACGACGTCGCCCACGTCGTCAACAACGCCTACGGCGTGCAGTCGTCCA
AGTGCATGCACGCCGTGAACGAGGCCACGCGAGTCGCACGGGTCGACGCCGTCGTGCAGAGCCTCGACAAGAATTTCTTGATGCCCGTCGGCGGCGCCAT
TGTGAGCTCGTCGAAAAAAGAGCTGGTCCACCAAGTCGCACAGGTGTACCCGGGGCGCGCGAGCAATTCGCCGAGCGTCGACTTCTTCATTACGATGCTG
CACATGGGGCGCACGGCCTACCGGAAACTGCTTCGCGATCGGAAAGAGCTAGCAGTGTATCTCAAGACGCAACTCCAGCAGGTCGCGAGCGAGTGCGGTG
AGCGCGTCATCGAGTCGCCGCAGAATGAGGTGCGATCAATACTCGTGAGTCTAGTTTGGGTGGAGGTCATGTTCAGCTCACGCGTTCTCATTTGCAGATC
TCCTCTGCCATGACGCTCACGACCTTTGCCTCTTCCGCCTCCGACGCCGCGACCCGCGCGCGGGAGCTCACGTTCTTTGGCGCCATGCTCTTTGCGCGCG
GCGTCTCGGGCACGCGCGTGGTCTCGTGTCTCGACACGAAAAGTATCGGCGGACTAGCGTTCGAGTCGTACGGCGCCCACTACAGCAACTACCCGCACCC
GTACATCACGTTTGCGTGTGCCGTCGGCATGACCCGCGACGAGATCGACCAGCTCACCAAGAAGCTCCGCACGACCATCGCTGAGTGGCGCAAGCAGCAT
CCGCAATCACTGCCACCGCAGTAAACCCCTGGTGTGAAGAGAAAACTAAAGTCTATTGCGCCTTTTCCCCACAGTCCACCTTGCACCGCCACGCTGTCAC
GAGCGGCCTACCAACCTATATCCATTCTTCCCATGGTTCAGTGCTTCTTGATCGCGCCACCGTTTGCCTTCGCGTTCTTCTTCTTCTTGCCAGGGGCAGA
TTCTTCCTTGATTGCAATCTCGTTGAGCAGTTCCTGGGCGATCGCATCGGCAGCAGCNNNNNNNNNNTTTATTCAACGACAGTCCATCTTGTGCCGCCAC
GACGTCACGAGCGGCCTACCTACCTATATCCATTCTTCCCATGNNNNNNNNNNGGCAGCAGATTCTTCCTTGATTGCGATCTCGTTGAGCAATTCCTGGG
CGATCGAATCGGCGGCTGCCGCGGCGTCCACTTCCTTTCGGCCCTTGGCGCCCTCGACGGCGTGCTCCGTGAAACGCTCGATAAACTTGGCGGCCTCCTG
CACGCGCGGGTCGTTGTCGCCGTATGCGTCTTGGAGCAGCGTGTGCACACGCTTCTCGTAGAGCAGCGCGTCGCGGTACCCACCGACAAGCGAACACGCG
AGCGCCATTTGGTGGAGCGTGTTGGCGGCCTGCACGCGATCAAACTCACCGCGCTGCAGCGACTCGCGGTAGCACAGCAGCGCGAGCGGCACCTGGGCAA
TGTCTTGGCACATGGAGCCCATGCGCAAGTACAGCGACGACACTTCGGGATAGTGCGGGCCCCCGCAAAGCTCGAGCAAATAGATCGCACGACGTAAGTG
GAACACGGCGAGGTCTGTCTGCGAGTTAGCGTGGAAAAACAACGCCAAGTTTGCGTGCGCAAACGCCGTATCGTGGTAGTCGATCCCCTGCAGCTGCGTG
TACAGCGCGAGCGCGCGTTGCTGCTGCACGATCGCGCCGGCCACGTCACCGGCATGGTACAGTACCGTTGCGATCGACGAACTGCAGAGTGCGGCGTCCT
CGTGGGCACCACCCACGACATGGTAGAGCAGCGTCGAGGCTTCCTGCAGTAGCTCGTATGCACTCGCCAAGGCACCACCACTGAGGTGGAGCCGCCCACG
CTCCAGCAACTGCTTGGCGTGGGCCAGAGGGTGCGCCGGCAGAGAGTGCTTGACGACTGGCACGACACCCGTGATGTCCTCGAGCTTGAATGGCGCCGCC
GAGGCAAAGTCGTAGGTCTTGCTGGCGACACGCAGGCCGAGGCGCTGGCAGAGACGGCGCAGCAAAACGTTCTTTTGCACGCGCTTAAACTTGGCCGTCG
CGCTCTCATCCTCGTTGTCCTCCGTGGAAGCTTCCGTGTACGGATGCCACAGTGCGAGCATGTACGCAAAGCGCTGCTGGATCTGAGTCGTGATGCGCTG
CCACACCGCCACACCATCCAGTCCATTCTCGTCCGCACGTGCAACAACCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGTTCTTCTTGGCAGTCTTCTTGTTCGGGTTCGTGTCACTCAGGCCCGCGGTCTTGGCCACCGCCGCGGCCGAGATCTCGTCCGCCGCGTCCACTTCTT
CCCATCCTCCAAAGATCGCGTTTAGTAACTGCACGAGTGCGTCGCCAGGGGCAGCGCGCACGACCGTATCGGCGTTCAGCAAATCGGCAACGATATGCTT
GACTGCACGAGTGATCATCTCGACTTCGAGCAGCTCCAAAATGTACTNNNNNNNNNNCAGCGATATGCTTGACTGCACGAGCGATCATCTCGACCTCGAG
CAGCTCCAAAATGTACTTGGAGATACCACCAAATGATTCCAGTTTCTTCACAAGAGCGGCCATGCGGCCCAAGTAGCGCATGTTGATACCGCACGAGTGC
ATGAGCTCGCTGAGTGCGTAGCCATCGGCAGGCGAGATCGCACCACGACGAATATCCGCCACAAACGATGGGATCACAACATTCTGCAAGTAGTCGGCGG
CATCACGGGCAGCGGCTTCGTCGGCCTTTGCTTCGTCGGCGTCCGTCGATGAGGCGTACTTCATGAACACATTTGGGCTCAGGCGCACACTTGGGACTGG
TTCCTCAGCTTCTTGGGCATTGTCATCCTTCTTGTCAGCCTCACCGTCAGCGCTCGCCTCCGTCGATTCGGCATCTCCACTTTCCTTCTTGTTTGCCTCT
GCAGTGTTGGCACCCCTACGCTCTTCGCGACGAGCCTTGCGAATCTGGTTTTGCTTCCACAGCGCGTAGAGTTTCACCAGCTCAGGTCGAAGCACCGCCA
CGTAGCCTTCATCCTGGCGATTGAAGCGCAAGCCGGTGCCGTTTGCGACAGCTTCCTGCTCTGGGGTAGCCTGAGGATCACGCTCAGCATAATAGGTCGC
ATCCTTGGGGGTGATACGCACCAGATCCAGCACATACATGCGTCCATCCGCACCGAGAATTCCCTTCGCTTCCACTGGTCCGCACAGCTTGACGACTGCA
GTGGTCGCTTCACCTCCGTTCACACCGCTGGCGCTATCAGCTTCGGGTGTAGGGTCTTCTTCGTTCTCATCCTTGCCAAGCGGCTGGATGCTGCGCTCCG
CAATGTGAAGTTTCTCGGCCGCCTGCTGCATGAGGGCGTGCATCTTTTCATTCGACGCGATCGTCTTGCCGCCGTCCACCGAGCCATACACAAGCTTGGA
TGACGCTTCACCCTGCAGGATTCCAGGAATGACGCTCTGGGCGATCACACGCATACCGAGGTAGTCCACGACAGTGGTGGCGAGTGTGTGCAGTCCGGGG
ATATCGGCGTCGTTGAAGGCCTTGACGCCCTGCAAGTCGCGGTTCGCTGACGAAAACGCAGCTTCTTCGGTGGAAATGTCCTTTGCACCGGGTTTCCCGT
CCACTGAGAGCGAGAAGAAGATGTTGTTGAAGACGTACACATGCGAGTTGGCTTCGTCCATCGGGTTGATCGGTGGGATGTGGCCCTCGACAATGGCAAC
GGCACCCTGCGTCGCCGCTTCCACAAATTCGTTGACGATCTTGTACATCACGCGGCTTCGCACGATTTGGTCCCGCAGCGTCTCAGCCGGGAGGTCGCGG
CAGCACTGGTACTCTTCGTTCCAGTCGCGCAAGACGCCACGTTCTTCCACACCAAACGTCGCACACAGCTCGTCCTCGGCGCGGTTCAGGTTGTATTCGT
GCTTGGTCACAGTAGGCAGCGTGGGCGTGTTCCACGGCAGCTTGCCGCTAATCTGGTTGCCGGCTGCGACCATCCACTCAATTGAGACGGGCCCTTGCTT
GGCCAGCACCGCCGCCTTGCTCAACAGCGACTCGTACGAAGTCTTGAACTTCGACGACGCCTGAAGCAGCACGTCCACTATCAAGTTCTCCGTCGTGGCA
TCCGCTCGCGGCTGCGGATCGAACTTGGCGGGTGTCGAGCGGTTCACGTAGAAGCCGTTGACGTGGGCCGTCACGTTGAACACGACATTGTCCTCGGTCG
TGACCTCCAGGTACATCAAATCGCCCGCGAGCTTGCGCGGTCCGGGTGGCGGGTTGTACCCCGAGAACACGATGCTCTTGATACACTGCGGCAGCTTGGC
CGACTCAAGCGAAAAGTCCGTGCTGCTCTCGTCGCCGCTGCTGACTTCGTTGACCGCCGTGGGCGACTTGGCGCCGCTCTTCTTCTTGCCCTTATTCTTC
TTCGACGGCGTGGTCTTGGCTTCCTTGGTGGGCTCGTCCGGCGATCGCTTGGAAGACGACGGCTTGGGTGCCATCGCGTAGAAGGCACCGAGATCCGCCA
CGACCGGCACCTCGACACCCTCCAGGCTCTTGTGGATGTCGCGCAGCTTCTGAAGCTGCTTTTCGTTGAATTCCTTCTGGGCCTTTTCGTCGAGTTCGCC
ATTGGCGTTTGCCTTGGCGGCAGCCGCCTCAGCCTTCGCAAGCTTGTCGGCCGTGGCTGCAGCCTCGGCATCGATGCCCTGCGGGATCGGCGGGTTCATG
AGCACCTCGCGGAAGCGACGCACGTGGGCGCGCACCTTGCGCGCGTCGTACTTTTCCAGCACCATGCGCAGCGTCACGCCGTCCGTCACGGCCTCGTACT
CGCCAAGCTCGACAAAGTCATTGAGCGGGACCCACTCGCCTTCGGCGTCGGGCTTGGGCGCCTCCAGGCGGTAGCACGTGTGGCATGCGAGTG