Description :
From Genome Similarity Track
Location :
Scaffold_39:31862- 33964
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012070Similar to Myo5a: Myosin-Va (Rattus norvegicus)

Sequence
2102 bases(100 bases per row)
AGTTGGAGTCACTGCCGTACCAGAACGAGAATCTCGGTGAATTCGGGATTGAAGACATGATCGCGCTCAATTACCTACATGAAGCCGCCATTCTGTACAA
TGTGAAGAAGCGGTTTCTCAAGAGGTTGCCGTACACATACACGGGGGATATCTGTATTGCTGTCAACCCGTACCAGTGGCTTCCTGAGCTTTATGCCGAG
GATATCCATACCCAGTATCTTACGAAAAATCGCGACGAGCTGCCTCCTCACGTGTATGCGACGTCTGTCGCGTCGTACAACGATATGAAGCGCAATGCGA
TGAACCAGTCGATTTTGGTGAGTGGCGAGTCCGGCGCAGGCAAAACGGAGACGACGAAGATTTTGATGAACCATTTGGCATCGATTGCCGGTGGACTGAA
CGATACCACGATCAAGAAGATCATTGAAGTTAACCCGCTCCTGGAATCGTTCGGCAATGCCAAAACCGTTCGCAACGACAACAGTAGTCGTTTTGGGAAG
TTCACGCAGCTTCAGTTCGACAAAGCTGGTATCCTCGTCGGCGCCAGGTGCCGAACGTATTTGCTCGAGAAAACGCGTGTGATCCACCATGAATCACCAG
AGCGGAATTACCACATCTTTTACCAGATTCTGGAGTCAACCAGTGCCCCAAAGTGGTATCTGGACAACTCCAAGTCGTACACATACACAGGAGACAACAC
AGCGATGAAGATTGAAGGTATCTCAGATGAAGCCCACTTCGAGAGAACGAGAACGGCACTTGGACTGATCGGACTCAGTTATGAAGAGCAGGAAGTACTG
TTTGAAGTGCTGGCGGGTATCTTGCATTTGGGTGAAATCAAGATTAACAAAAAGAACGGAAACGACGAAGAAGCTGTGATTGCTCCGAATGATCCAGCGG
CTGCATCGACCACAGCGCTGTTTGGTATCTCAGTTGAAGACCTTGAAACTGCGTTGTGCTCTCGAAAAATAGCTGTATCTGGTGAAATTCTGAAGAAACA
CCTTCGTAAAGAGCAAGCCGAAGAATGCCGTGATGCTCTGGCAAAGGCTACCTATTCGAACATTTTCGATTGGCTGGTGTCTGTCATCAATGTCTCGCTT
GAGAATGACAAGAAGATGTGTAATCACGTGGGCATTCTCGATATTTTCGGGTTCGAGCATTTCAAGCACAACTCGTTTGAGCAATTCTGTATCAACTACG
CAAACGAAAAACTGCAACAGAAGTTTACGCAGGATGTGTTCAAAACTGTTCAGCTTGAATATGAAGCCGAAGGAATTATCTGGAGCCACATTGATTTTGC
AGATAACCAAGATGTGATTTCGATCATTGAAGACCGACTGGGCATTATTTCGCTGCTGAACGACGAAGTGATGAGACCGAAGGGAAATGATGAGTCGTTG
GTGTCGAAGCTCACGTCGATTCACAAGGAAGACAAACACGTGATTGAGTTCCCTAGAACGTCGAGAACCCAATTTACAATCAAGCACTATGCCGCAGCAG
TCACGTACGAATCGTTGGGATTTCTGGAGAAACACAAGGACGCGTTGCTTCCTGACCTCTCGGATTTGATGCGCAGCTCATCTAAATCTTTTCTAAGCGA
CATTTTTGCAGCCAAGGGGAGTGAAGCTGAAAGTAGTACGGCAAAATTGCCTCAAGGCGGAAGTGCCAGAAGAGGAGGAGGGCGAGCAGCTGGTGGTGCG
CTGTCGGTGGCGAACGTTGGCACTCAGTTCAAGGATAACTTGAATGAGCTCATGACCAGCATTCGCCAAACCAAGGTCCATTATGTGCGCTGCATCAAAC
CAAACCAAAAGAAGAGTCCCCATGAGATGGATCAGCCTATGGTCGTGGCGCAGCTGCGGTGTGCTGGTGTGATTGAAGCCATTCGAATCTCTCGTGTTGC
GTATCCGAATCGTCACCTTCTCGAAGAATTGCTCGATAAGTTTTGGGTTTTCGACAAACACAGGAAGACCGACGTACCTCTTGTTGACAGATGCCAGACG
GTGATGGAAAAGATGAGCTTCTCCACGCCTACCCAGTATCAAATCGGTCGCACGAGAATCTACTTTCGTTATGGAGTGTTGGAAGAAATGGAAGAAAGGA
AG