Description :
From Genome Similarity Track
Location :
Scaffold_414:3186- 9034
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_414-fgenesh-gene-0.5Signal peptide peptidase
Pytir_DAOMBR486maker-pir_contig_414-fgenesh-gene-0.6Diaminopimelate decarboxylase
Pytir_DAOMBR486maker-pir_contig_414-snap-gene-0.16Elongation of very long chain fatty acids protein

Sequence
5848 bases(100 bases per row)
GTCGAGTACTTTTGGCATGCGCAGCAGGATCGGCATGAGTTCCTTCTGGCACTTGTAGGCCGTGTCGGTCGGATACCGCAGACAGTAGCCGCTGCTAGCC
GTGGCCTTGGCCTGGCTGCCGCCCGTCGCCACCTTGATCATCACGCTCTCCTTGAAGATCAGCGGCGAGATGAACACCATGAACACGTCGTAGCAGAACA
CGAGCACGAGCAGCACCGTGGCGATCTTGAGGTTCGGCAGTCGCACGGTCTTGAGAAACACCATGCAGAAGCAGATCCCGAACACGTCCTGGAACACCCA
CGAGTAATCTTCGTGGCGCATCACGAACCAGAACACCGACGCGCCGATCGCTAGCACAAGCGCGATGAGGTCACCCACGGTCCAGAGCGCCGGCAGAAGG
TACTCGGACTGGTACGAGCAGTTCTGGAACGGCTGCTTGCGCAGCAGCTTGAGGCGGTTGCATAGCGGTCCCCAGAGCTCCTGGAACGCGCACGAGACTG
AGCCGATCGTGAACCCCACGACGATCACGAGCACTACGTCCACATAGAACAGCAGCAGCAGGAACGCCGAGCCGATGACCAGGAACCCAAACGCGTGGTA
GATCGTTAGGTCCATCGCTTCCTCCAATGCTGCGGCCTCTTCGTGCTCCTGGTACGCGATTCGCGCCTGCGCGGATTCCTCCGAGGACGTCGCGTCCGTC
GTGACGAGCGCGACCTTGAGCTGCGCTTTGGTGCGCTCGTACTGCGCGCCTTTATAGCCGCCCGTCATGACCGTCGCGACTGCGAGAACCCAGATGATGA
ACTGCGACGGGTCCACCGTCGGCGGGTCTCGCTCGTAGAACGTCAGCAGGTTCTCCGGGTCCGCCGTGAGTAGCTCCTTGAGTATGTTGCCGTCCACGAT
CTTGAGGCGAATGACCGGGATCGTGATGTTGTCGCGGTCCTGGTCTTCGACGAAGCTGCCAAAGCCCATGGTGTCCGGGATGTCCCACGCGCAGCAGACC
TGTTTGCCCACGCCCGTAGGAACGCACATGCTCGACTCGCACATCGAGTTGTCCGTGCAGCTCGTGACATTCGGCAACTGACTCCATCCTGTTGCCGTGA
AATCCAGTAGCGACGCCTCTGACACGCTGCTGCCCACCTCTGCATGGCCGCGCTTGCAACTGAACTCCATGCCGAGCGCCTCGCCGCGCTCCTTCTCCGA
GAGCGACGCGTTGTTCCGCGCCGACAGTGTGCGGTTTGCCACCTGCTCGAGCGTGTCGGTCACGATGAGCGCCGCCGCGCCGAGCTGCTGTGCGTAGAAC
GCCTTCTCTGCGTACTCGCAGAGTCCGCGGTCGACCACGAGGATGAATGGGGCTTCGGGCGTCGTGAAGTTGCCGGCGCCGCCCTGCTGCTTGATCAGCG
TCTGCATGGACGTGCATCCGAAGCGGTCCGTGAACACGCCGCTGTTGTAGTACATCCGGAAGTAGCGGCGCTTGGCGTTGTCGTGCATCTTCTCGGACGG
CAGTGCGCTTCCCCAGGACGCGTCCGAGGCGCTCGAGCCGTAGAACACGTCCTCGGTCTGCTTGACGGTCACGACCGCCGTGGACACGGGGCTCGCGGTG
TCGGACGCGCGTGCGATGCCCACTGAGCTGCTGGTGAGCAGCGCTACGAGCGCCGCGGCGCCTGCTATTGAGGAGAGCGGGCGGTGGCGCATGCTGCTAC
CTCTACTGTGGCGACGGAGCCACCGAGAGAGAAAGAGAGCTTGTCTGTGGGAAGTGATTCTCCGCAGTGTGTGCGAGTGCGGTGCTAATGGGGAAGAGTT
GTTGTTTCTACTGTATCCCTTCCTCGGAAATGTCACTATGAAGTGAGGCTATTGTGTATTGGCGAAAAAGGCTGGAACGCTGATAAAAAAAGAAAAACAC
ACAGAGTAACGGATGGAGGTTGCGCGAAGGTCGCGCGAAGGTTGCGCGAAGCGTGACAAAGTCAGCTCGCTCCTTTTTTTATTCTGTTGGAATAGCGAAT
CCCTATCCCCTCAATTTCTTTTTTGAGCGGATTTTGTAAATTTAGACTTTTTGATCTGGATGTTTTGCGAGGCAAAAAAGCTGATTCAGTCTCTAAATAT
AGACACACATCAACCCAAAAGCCATCTGGTCTCGACATGACATGCCCTGCCGTTGCACTCTCTCTGGTCTTGCTGCGGTGCTCCATTGAGATGGGGAGTG
GCGACAAAAAAGTCGAGTTGAGTGGTCAGCACCGCTGTTCAGAGATGGCCTCTCTGGTGGTGTGGTGATCTCGGAAGAGATTTGCGATGCAGTATCTGCA
TCCGCGTCTCGCGTGCGTGGAGCTTTTCGACGACACTCCTCGTGCTGACCCTGATGACGTTTTGATTTTGTGATTCAAGGCACGGCCGTTTTGCTGCTGG
AACCTGCAGATTTGCTTCAGTCTGGATTTGCTAGTGCTGCATCGTGGTACAGTACAGTATTCGCGGGCAGAGTCAGGAGTGCATTGCTGTTTGCTCCTTG
GCATACGAATTGCGGTATAGTGCTTTGAGAACATGGCTCCAGACCAGTTGGTTGCCTTGGTCCAAACGAGGGTAGCTCCGTCAAAGCATCAACGTGGGCA
CCATCTATCAGTTGCATTTAATTTGTGGGTTGTTCATTTTTATCTATTTACCTTGAAGAGCCAAGAAAACCTGCAAGCCGTACGAATGAGAGGAGGGTCT
ACTCGATCTTCACACGTTTACAGATCGGCTGGCAGGACGCAGTTTCCGTAGAGAGCGTCGTACGTCTCACGCTGGCGGCTGTGGGAGCAAACAAAGCAAT
CAGGGTTAGAGTTAGTAAGCGCACCATTCCCGCATCAAAACAGCAGCAACTATACTGCAAGTTCACTTACATGAGCGTGTCCGAGCCGTCCGGTCGGATC
AGGATCTCTGGCGCGCGGAGCTTGCCGTTGTACTGGAAGCCCATCGAGTGCGAGTGCGCGCCGGTGTCGTGGATCACGAAGAGGTCGCCGACTTGCGCCT
TTGGCAGCGAGCGGTCCTTTGCGAACCAGTCGTTGTTCTCGCAGAGCGTGCCGACGACGTGCGACGGCACGCGCTCTGTGGACGCATCACCCTCGCGCGT
TGGAATCGTGATGTGGTGGTACGAGCCGTACATGCCCGGGCGCATCAGGTGCGCCATGCACGCGTCGACGCCGTAGTAGAGGCCGTAGGTGTTCTTGATG
GCTTCGCAGCGCGTCACCAGCCAGCCGTATGGACCGGTCATGAAGCGACCGTTCTCCATGCACAGGCGAGGAATCGACGTTAAGCCGTGGGTGCGCATGG
CTTGGTCGAACACGTCGCGAAGCATCTGGCTGATTGAGTCAAGGTCCACGGTCTCCTGGTCCGGGCGGTACGGGATGCCGAGACCGCCGCCGATGTTCAT
GAACTCGAACTCGATGCCCAGCTCCTTCTTCAGCGTCACAATCGTGTCGAAGAGAACCGTAACAGTGTCCTTCCAGTACTCCTGGTTCATGACGCACGAG
CCGGTCATCATGTGGATGCCGAAGCGGGTCGCACCGGCAGCCTTCGCCTTGCGGTACGCCTCCACGATCTGGAACGGAGGCACGCCAAACTTGGCGTCTG
GGCCGCCCAGAACGTTCGACTTGGTCTCCGAGTCCGTGCGGCCGAGTCCCTAGAGTTGTGGCAAATGAAAGAAGTTACATTTGTTAGTGGAACTGAACAT
CGTGGGAGTGGCTACGGTATTCACTTGCAAGCAGTTAGCGCACCGGGTTCAATCGGAAACTGATGAGATCGGAGCAGCGACCACGGACGGACACGAGGCT
GTCAACCAATGACACGTCTGCAACAACAAAAACAATGCAATGAATATTAGACATCATTTCGAGCAAATGGTTGCATGGATCTTGAAGAGCTGCTCCACAC
GTACCATCCAAGTTCATAATGACGCCCTGGTCGAACGCAGCCGCGAGGTCGCTCTGTTCCATTCGAACGACACGGCAAACACAATCAGCATTGCATCCAT
GACACGCCATACAATCGGTACTTCGCAATCGCAATCGCACACACGAATGAGCATAAGACGCCATTGACATACCTTGGAAGTGAAATTGGACGTGAAGATG
ACCTGGTCGCCCGGGATGCCGAGCTTCTGGACGCTGTAGAGCTCGGCGGAGGACGAGCAATCCATCCCGCAGCCCTCATCGTGCAGCACCTTGAGGATGG
CTGGGTTCGGCAGCGCCTTGACGGCGAAGAACTGCTGGAAGTCCGGGAAGTGCTTGCGGAACGCCGCCAGCAGCTTGCGCGCGTTCTCGCGGATGAGCTG
CTCGTCGTAGATCTGCAGCGGCGTGCCGTACTTCTCGGCGAGCTGCTCGAGCTTCTGTTCGGTGGAGCTGCGGAGCGAGAGCGGCATCGTGGGTGGCTGT
CTAACAGCTATCTGGTGATGGCGCACGGAGGCAGAATGCGGAATGCCTTGCTCTGGTCTGTCAAAATGTGTGTTTGCCCAAGCGGCATGGGACAGTTCAA
CATCGGAGCTGGTGGTGAAAGCGGCAAATCGGTGTGGCCCACACTGCGTTCCGCCGCGCCACAAGAATTTGCCAGGATCCCAAGTGGCCCACACAAAGTA
CAGTATACGAAGATATACGATTGTCTGGTTGTTTTGGCTTGTGTTATACGGATGCAGCCATTTCGAGCAGTCGTCGTCGATCTTCGAAAGTGGCTCACAT
TATTGATGGCATCATTCCCACGCATGAATGGCTGCGAATATGGTGACGGCAGAAGCCTTGGGTTCTGCTCCAATCTGTTGATTGGGGAGCAAAGAGAAAC
AGAGGGGCGGTTGCGCCATCGCAATGGCTGCAAGGAAAGACTCGGATCTGGTCTTCACTGCGTTGATGTGGAATGAGGACGCCTGCTCACAGGGTGCGAT
CAAAAGAAAGGCTACCTGAAGCGAGCTCGATCTTTTGCGCTGAGAAATCAAGGGGCGACGAATGGCACATGCGACAGACTCTCTCACTCACTTCAACAAC
AACAGGTCCAACGCTCAGGCAATTGGATCGCAGAGAAAACAGCCACGCACACAGTAGAAAGAGCCAAAGCGCTTGTCGCGTTCCATTAGATTTAGAATGT
CGGACGCCATGAAGGCCTTCCGCTACCACAAATCTCTTTTCTTGGGCTCCTTTGCAATGCAGAGCGTGCGCACTTCGCATGCAAAAGAGCACGCGACGCG
ACGCACACACGCACGTGTCTTGTTTTCTTCCATGCAAACAGAGCTCGTGGGTGGGCGAGTATACAGACACAAGGTGACTACCAGTAGGTAGGTAGATCGT
ACGGCCGCACGAGACATCCCTTCGCAAGCAGCTAGCTAGCTAGCCGTCGTCGTGATGGACGGCAATCTATTGGTGCTTCTTCTTGCCGCCGGTCACCGCC
TTGCGTGGCTTGCTGCAGTACGAGCGCACGAAGAAGTTCATGAAGAGCCAGAAGAGCGTCTGGATGTACACCATGTAGAACATTGGGATCTTGGTCGGCA
TGCCCGAGCACTGGCGCGAGACCATGAAGTAACCCTGCACGTTCATCGTCAGGAACTGGATCATCTGCATGGCCGTGAGGTACTTCTTCCACCAGATGTC
CTTCGTGTGCGCGCTCACAAAGTAGTACATGTACATGATCGTGTGGATGAAGCCGTTCAAGATGATGGTCGCGAAGATGTCTCCGTCGTAGGCGACACGC
GAGTTCACAAAGTAAATCTGCCATTCAGGATAAGTAAAAAGCGTGGAGTGAGTGGACGGGTCTAGGCAAAGAGAATGAGGCACTGGGTACCACGGAGAAG
AAGGACACAACACTTACAAAGAAGATGGTCAGGTGGTGGTACACGTGG