Description :
From Genome Similarity Track
Location :
Scaffold_896:3186- 4946
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_896-fgenesh-gene-0.0Glyceraldehyde-3-phosphate dehydrogenase

Sequence
1760 bases(100 bases per row)
CGCGTCGAGCGACTTTGTCGGCGCGCGCTCGTCGGGCACGATTGACGGCAAGGCCACGATTGTCCAGGGCAACAAGATTGTCCTGTACGTCTGGTACGAC
AATGAGTTTGGCTACAGCTGCCAGGTCGTGCGTGTGCTTCAGACGCTCGAAGGCATCAAGCACACGCGCTTCCCGGACGCGTCTCAGGTCGAGGCCATCG
ACAAGGCGCTCCACCTCGCCGTCGACTGGTAGACGCCACGGTCTCCTGTTGGTTTGTTTTCTAGGAGCAGATCGCGAATGAAAGAGGTAGTGGATCCTCT
CGAGTGTACGCATCTACACGCTCATCTCGCGATGCATCCGCATGCACGCTTCCCCTCCCCCAATACNNNNNNNNNNAGTCCCGAGTGACTGAGATCATGG
ATACCCTCGAGTGTCGCTCATCTTGCGATCCATCCGCATACACGCTTCCCCTCCCCCAATACAGTATCGTACAACTATCACCCATCCACCCCTTGGAAAA
CACTTGCTGGTGGAAATAGCTTGTGTATGGGCGCGTCGTTTCGTACTGTCGCAGCTCTCGCAAACCGCAATCGAATTCACCCCTCACAAATCACGGGGAG
CTATGCACCGCGGCGACGAAGGCGTACGAGCAGCGCCTTCGACTCCTCCTCCTCCTCCTCCNNNNNNNNNNGAGTGGAAATAGCCTTGTGTGGGCGCGTC
GTTTCGCACAGTCGCAGCTCTCGAAAACGGTAATTGGGATCGCTGCTCACAAATCACGGGGAGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGAAAGCACAGCAATCTCCGCTCTGTGTCACCCACGACGAAGACCTCCACGCGAGACCTCGCCATGCGGTCGTGGAACTCCCACAGCACGAGCAGT
GACAGCTCCACCGTATTGGTCCATGATCATAGCAGGGTTCGCCAGCACGCAGCAGCGAATAATCCCCACACGTACCACATGCTGTCAGATCGAACAGCAC
CCACCTCAGCACCAGTCGCGCGGCCACCTCCCTCCAAGCTCAAAGCGCAAGTCGCCAAGGTCCTGTACCATCCCGATACGGACGCCAACGGGCCGCACGT
GCCTCATGACGAGCTGCAACAGATCAAAGATTCGGTCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTGTCGAGCAGGAAAACGTTGGGCTGCTCAAGAGTTTCCAGCTGCTCGAGCAGCGGATCCACGCNNNNNNNNNNATTCACGAT
GCTCCGTCGCTCGCGACGCGGTCCATGCACGTCCGCAGTGATGACCACACCAGCAAACACAACAGTCTCCGATCCGTGTCGCCCACGACGAAGAGCTCCA
CGCGAGACCTCGCCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATCATAAGCTGTCGATTCGAACAGCACCCACCTCAGCGCC
AGTCGCACGGCCACCTCCGTCCAAGCTCAAAGCGCAAGTCGCCAAGGTCCTGTACCGTCCCGATACGGACGACAACGGGCTGCAGGTGCCTCATGACGAG
CTGCAGCAGATCAAAGATTCGGTCGAGCGATTACGCGCACAGCGCACCCACGTCGAGCAG