Description :
From Genome Similarity Track
Location :
scaffold_48:318521- 321270
Transcript NameFunction/comments
g7503.t1 succinate semialdehyde dehydrogenase, mitochondrial precursor

Sequence
2749 bases(100 bases per row)
CCCCAAAGCGTGCATAAACCGCTGGGTGACTCTACTGATACCATGAATTCGCGTCGTTCCACCGGCAGTATTGGGACTACTCGATCACTCCAGTGGCAGT
ATCGATATGGTTACGAATACGACGCTGACGGTAAGCTTGTCAAGAGCTCCAGGTCACAACCGCGGCCTATATGGACCGAACACACTGACCCTGACTGCGG
CATGGCCTATTACTACAACGTGCTCACCAATGAGTATCGATGGGAGAAACCTGCAGACTTCGACATCAACTATGAAGCTTTTGCTAGCGGACGTAGTGCA
AGCAGCTCCGCTCGTAAGTGGTTCGAGATGGCCCATCAAAAGCAAAATGCCGACGGCAGCAGCTCTCTCAGTTCTCGATCGTCGAAGACGCGCGCTTTCG
GAAAGAAGTGGGTGGAGCTGGTCGATCCAGAGACGCAAAACACGTACTACTACAACGAGGTGACAGGAGAGACGCGGTGGTCCCTCTCTCCTCGCAGTGC
ATTGGACACTTCAGATACGGAAGATCAGATCTCCTTGGCCCTGCTCGCGCAGGTGAAGCAACTTCGCGAGACGCCAGTGCCGTATTCATCTCGGGACCAG
CATATGAGCTGGCTGGAAGCAGCTATCGCCGAGAAGGGCTGGAAAAAAGCAGACGCGATCGTCCAGCAAATCTTCATTCGTGAACAGAGCCAAGCTGTAA
CTGACCGTCGAGCTAGAATCGCAGCCGAGGAAGCGGCGAGAGCACCTGTCACCTCAGATACAGCGAGCAATTTCTTGACAAGCAGCAATGTTTCCTCTGT
TTCGACTCCGAGCGCTTGGATCGAATGCACTGACGAAAGCAGTGGCGCTACGTACTTTTACAACCAGGTGACCGGAGAGACAACGTGGACCAAACCATCA
ACAGCACCTGCAGGTCAGTGGGAAGTGGTGCAGGATAACGATGACAAGGCGTATTACTACAACCCTGTCACAGGCGAGACGGTATGGTCAGAGCCCACCC
GGTGAGTTCGAAGGAACATATAACTTTATTCCACAGTACACGTCTGGGTCAAAACAATCTGGCAATGGAAACTTATGCCTCCAGGCCGCCCATGCAGACC
ATCTTCGTCTCCTGATACTCGTCCAAGCCCATGAACGAACCTTCACGACCGAGGCCAGACTGCTTCACGCCGCCAAACGGAGCCTGCACGTTCGAAATCA
CGCCCGTGTTCACACCGATCATACCGCAGTCTAGCGCAGCAGCAACGCGCCAAGTGCGAGACAGGTCCTGCGAGAAGAAGTACCCGGCCAAGCCGGCCTC
CGTGCCGTTGGCCATCTCGATCACGTCCTCTTCAGTAGAAAACTTGAACAGCGGTACAACGGGTCCGAAGATCTCCTCGCTCCAGACGCGCATGGTGTCG
TCAACGTGGGCGAGCACCGTAGCCTCGTAGAAGTTGCGGCCGATGTCACTGCGCTTGCCGCCAACGAGAGCCGTCGCGCCGTTCGTGACAGCATCCTCCA
CGAGCTCCGAGGTCTTGAGGAAGGCGTTGGGGCCAATCAGCGGGCCGAGGTTCACGCCTTCTTCGCGCGGCGGGCCCATTTTGAGCTTCTTGACGCGCTC
CACCAGCTTGGCCGCGAACTCGTCGTAGATGCTCGCATGGATGAAGATGCGGTTGCTGCACACGCACGTCTGGCCGGTGTTGCGGAACTTGGAGGCCATA
AGGCCGTCCAGGGCCTTGTCAACGTCGGCATCTTCGAACACAATGAACGGCGCGTTGCCGCCGAGCTCCAGCGACACGCGTTTTACCGTCTCGGCAGATT
GCTCCATCAGCAGCTTGCCGACGCGAGTAGAGCCGGTAAACGAGATCTTGCGGACGTCGTGGCTGCTGGTGAGCGCTCCACCGACCTCGGCCGCCTTGTC
ATTGGGCGACGGCACCACGTTGATGACTCCGGCGGGAATGCCGACGTCCTCCGCCAGCTTGGCCAGCGCCAGCGCCGACAGTGGCGTCTCCGCAGCAGGC
TTGACCACTGCCGTGCACCCTGCAGCCAAACAGGGCCCCAGCTTGCGGGTGATCATGGCCAGCGGGAAGTTCCAGGGCGTGACGATCCCACAGACACCCA
CGGGCTCCTTGATAGCCAGGATCTTGTGGTCGGGCGCCGATGTGGACGGCAGGAAGCCGCCCGAGTGCATGATCTCATGCGCGTAGAAGTCAATGAAGCC
AGCAGCGTAGGCCACCTCGCCCTTGGCCTCGGGCTGTGGCTTGCCGCTTTCCACGGAGGCGATGACGGCCAGGTCCTCCGTGTTGGCCACGATGGCGGCG
TGCCACTTTTTGAGCAGCACGGAGCGCGCGGCGGGCGTGGTCTTGCGCCACTTTTTCTGGGCCGCCAGCGCCGCCGCGATGGCCTCATGGGTCTCGACGC
GACCCATGTTGGCCACGCGCGCGATCTCCTTATCGGTGGATGGGTCCATCACGGCGAAGTGCTTGTTGGAGTGCGCCTCGACCCACTTGCCGTTGATGAA
GCCCGCCGACTGGATCAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGCGCGTGGCCAACGAAGCCGATGGCAGCACGGAGCGGTGGATCTTGGAC
GACAGCATGGCGGAATGAAGGGCGAGCGGGCGCGGTTTGGGCTCGACGGTGCAAGTTCGGAAGTGAGCCGTTGCGGAAGCAGTGCTTCGACCGCCAGGAC
CACTACTTGGCGTTTGTATGGGGTACGTCAGCAACGCGTACGCTCCCAA