Description :
From Genome Similarity Track
Location :
contig_42:318481- 319883
Transcript NameFunction/comments
g7737.t1hypothetical protein

Sequence
1402 bases(100 bases per row)
CTGCGCCTTGTTGGCGCCGCTTTCCCAGTCGTAGTACCAGCGCGAGAAAGGCTTGCCGTTGAGGTGGAACACGAGCGGTTTCCGGTCGTCTGCCGGCATG
CCCGGCGTGCGGATGGTGGTCACGAGTCCGGACGGCCGATCGAGTGCGCCTGCCACCCACTGCCCCTCGAGGTTGTTGTCGGACTGCGTGCCGGCCGCCA
TCTTGTCCACCTGGACGCACTCACCCGGTCGGAGACTCACGTCGTTCACGGCCTCGAAGCGCGCAAAGACGGCCAGGATCTCGCTCGGCGGAGGGTCCGT
CGGCGCGGCATCGGGAGACCGGATCCCCAGCTGCACGCGCACACTCAGCGACGTGCCGCAGTAGCTGCGGTCGATGTGGTCAGGGCAACAGTGCGGGAAG
CACCTGCAACACGACCACAATGGGCAAAAGGACGCACCACCAGAGCCACGTGAGCGGAATGGACTTGCAGTCAGCGGACGGACTCATTGAGAAGAGTCCC
AAATGGTCCGTTTCTTACCGAAGAATCTTGAGGCCTTTGGTGCGGTTGCTCCTGCAGAACAGCAGCAAAGAGGCAACACGGACGTATGGGAAGTGAGCGA
CGGCGGCTTTTTTTTTTTTCTATGAGTGGCTTAGGTTTTAGGCTCTAGTAAAAAAAAAAAAGAATACTATTGTACTGGCCAAAATAGTTGATACCAGGAA
TTGTAACACGAGCACATTTGCTGTCATTGCTCATCTAATATTAGACGTATGGGGGTGTAACGACCCGCAAAATGATGCAGGGCGTCAGCGCTAGCGACTG
CAGTTAGTTTTATACGCTCCCATCCACAAGAAGAATGGTAAGAGGTAAACGACTAAGTGATGCTGAGCGGGATATGATCGTGAACGCGTACAAATTCTTC
AAAAATCAGCGGCAAGGAGAACCCGAGGCGTCAGGGCGAACGCGCAGAATGGTTTACCAGTGTATTGGGACACCAGAGGCCACAGTAGGACGCGTCTGGA
AGGCGTATCAGGACCGCGAAAGCTCTCGACCTGCGGAGGTTCGTGTGATTTACTTACCTTAACGATACATATCAATAACCTGTAATAAAATAATGCAGGC
ACCGGTCGAGGAGAGTCGAGGGCGCCCACGGAGCTATGAACCCGAAGACGTCTCGCCCGCCATCAACGCGTACATTGAAAAGTGCAATAAGGAACGACAG
CCCATTACTGCACAAATGATTAGTGATGAAGTTCTTCGGTGCACGACTATTAAGATCTCTAGGCGTTCAATGAGCCGACTTTTACGACGTCTTGGCTATA
GCTACATCAAGGGCGAAAGTCGCCATTACCTTGCCGACTCTGTGCAGAATGTGGCGTATCGAGCGACCTATCTACAGCAAAAGGTGGCCAATCGGGATCG
TA