Description :
From Genome Similarity Track
Location :
Scaffold_292:318480- 320198
Transcript NameFunction/comments
Aphin_H310_08649actinrelated protein 2/3 complex subunit putative

Sequence
1718 bases(100 bases per row)
TTCAACCTGACGGACAGCATCACGTGTCATGCATGGAACCAAGACCGCTCAAAGGTGGCCATCTGCCCCAACACAAATGAAATCTGGATCTATTCGAACT
GCCACGCACCGGACGCGTCGCAGTGGCGCAAAGAAGCTGTCTTGACGGAGGTAGGTCGTACGCAGTTTTGAGATCCTTTCGAGTTGGCTGCATTGGTTTC
GTGCGTAGCACGATATGGTCGTGAGTGGGTTGGATTGGTCCCCCGTACACGATATGCTTGTGTCGTGCTCGCACGACCGATCTGCGTTCGTATGGAAGTA
CGAGCCTAGTGAACGCAAGTGGAAACCGTCCCTTGTGGTGCTTCGCATCACCCGCGCCGCTATGACGGTCAAGTGGAGTCCCGATGGTACGTCCATCGCG
TCATGCATTGACACGCTGTCCGTCGCCCATAACCCACTGTAGGTAAGAAGTTTGCTGTCGGAAGCAGCGCGAAGTGTGTGTCGGTCTGCTATTATGTGCA
GGCCGACAACTGGTGGATCAGTAAAGTGATCAAGAAGCACAAGTCCACGTATGCTCATCTTCACACTCACTCATCTCCATGCATGTTTCCTCACCGTACG
ATAGTGTCGTTGACGTGGACTGGCATCCCAACTCGCAACTCCTGTTGACTGCGTCCACGGATATGCAATGCCGAGTCTTTGCCGCGTACATTTCGGACGT
CGATGGTTCGCCGGACGCCGGTCCGTTCGCAGCTATGGCGCCGTTTGGAGAAGTCATGGCGGAATTTGACAACGCCAATGCGTGGGTGAACGCCGCGGTG
TGGTCACCATCGGGCACTCGCTTGGCATTTGCCGGCCATGGATCGTCGATTCACTTTGTTCAATTCGGACGACCCGGCGAAGCGCCCAAGCTGCAGGTGG
AGTGTTCAAGTGCTTGTGGCCTGTCAGTGTGCCGACAGTGTTTGTCACTGTCAGTCTTGTGCTTTTTGAACGCATATGGCTTTGCCGGCATGCCGAGTCT
TGATGAATGTATTTGCTTTGGTCCCCATGGCCATCTCGATGTAGAAACTCTACACGGTGGAGTGGTTTCATCCGTGTTTGGCTGATGTTGAATGATGCCG
CCGGTGTTCTTGTTGAATCGGTTTGCCTGGCATGATTGTCCTGTTTACATCGATGGTCGTCGCGCGTAGACTATTCGCTTCTCGCATCTGCCGTTGACCC
GATTGCTGTTCCTATCGAACGATGCGGTCGTCGGGTGTGGCCATGACTTCAACCTGCTCCTCTTCACGACGTCGGCACAAGGCTTTTGGTCGTTCTCCGA
GCTACTGGACAAGAAGAGCTCGGCCGGCACGGCCGCCAAGGCAGACAACAGCGAGTTTAACAACGGTACGAAAAAAGATTCATCATCCGTTGGCAACAAA
CTCAACGAGAGTGGCGATGTGGCAGTGCGCAAACTCTGGGACAGCAAAGTGAACCGCGGTCAGTCGGCGGAGGCAACTTCGGGCGACAAGGGAGCACTTT
GGACGTACGTACTTACTCGACGATTCGGCCGCGATTCGAGATTTTTTATCGTGCGACCACAGGAAACACGAGAACACGATCACGAGCATCCAAGTGTTGA
AAGCGTCTCCGAACGGACACGTGACTGAGTTTTCGACGTCCGGGCTGGACGGCCGCGTTGTCACGTGGAAACTCAACAGCTTGAACTTGGACATGGCCAA
GTTGCGCCTCTAAGTGGA