Description :
From Genome Similarity Track
Location :
Scaffold_100:31842- 34524
Sequence
2682 bases(100 bases per row)
AAAAAGCGCACCACTCTGTTTATGGTATCAACTAGACTTTTCTTAGAACTAGGGGCAAAGCCTGCATTTATGTATTTGCAGGACTTTTATTTGACAACGT
TAATGACTACCAATATCGTTAGAGAAGGACAAAATCGTCTGAGCATAGGGTAACTGCTTCCTGCGAAAACATAACTAGTCTTTAGTCAAATAAAACCTAA
GTTATAGACGTACACAATACAAAAAAATGACTATATATAGAAGCGAAAAGATGGTCGTGGTTTGAGAGATTCCTGCTGGGGTTACATTAGGTGACGCGCA
AGTGGACAATCGAGTCTACGATCGAGATCCAGATTGGCAAATTTATCCATTCACAGCTACCTTATAATAATATCGGAAAGCTCACATTGTCATGACGTAT
CGTTTGGAATTTGATGTCAAGGTCGGAGCACGCTCGTCACAGTGTGTAAGAACTTCAATCAGCTCCCTGCTGGAGCTTAAGCCAGTTCTTGTACATTTCA
AACCTAGAGATGAAAATGAATACTGAATACACCGAATCGTTAGCTACTATCCCTAAGTCGCCTAACTGTCATTAACGGTCTCAAACCTTTCCCATTCAAC
TTTCCCATTTATAGGACCTTTCCCACATTGCAGCTCTCAGCTCTCTTTTCTTCTCTTCCCAAATTACTGTTGTTCAAGTGTTCGTTCTCCCTTCTTGAAG
TTTTCTCTTCGATTATCAGCATCTCCAAGACCGAGTACATACAACAGTCGCTTCAATATCTTCTTTTCTAAAGCTTTAGTAAACACATCTGCGGAATTAT
GCCCTGCCTTCGCCTTGCTGTAATGGCTCCTTTCTCGACTTGTTTGCGCACATAGTGCCATCTTAGTTCTATGCGCCTTGTTCTCCGAATGTATGTGGGA
TTTATAGCCATTACATAAGCCACTTGACTGTCAATACCGATGCGTTATGATAACTACTTCTGTGGCAGTATATCTTGCAGAATATTTCTCATCGCAAGTG
CCACCATGGATGCTTCACACGCAAGTGCCACACTCTCAGCTCAGCGATTGACAGTGCAGTGATTTTGTGCCGGCGTGACGTCCACGCGATAGCGCCATTC
AATAATATACATACAAATCATGTAGTGATTTTCCTCTCCTCCAGATCATTGGCCCAGTTGCTATAACACAATCTCTTCGCAATAATATCGCCTTTTGGCT
GCTGCTTCTTTCACATGTAGGTGATTCTGTAATCTGGCGCGCCAACTGAGTAGTGCAGAACTCGTTTTCACGGCCCTAATATGCTTGGACGCATGACAAA
GCGAATTAATTAACCTAAGGCGAATGCCGAAACAGGTCTCTTCCTGGTGGCCAGGTACATGGGCATCCCGACTGCCCCTCGGTACAGAAATTTCACATTT
ATGTACTCATTTTCACTAGCTGGGTTGAGATGAATATTCACTCTTATGGGGTTTACCACAGCATGAGCGTCCACCTATTTACATAATGCTTAAATTTCGC
GTGTATATTTGCATTGCTCAACAGAGAATCTGCTCCGGATTCTGCTCGATCTAGTGCTAAGGTAGTCTGTGAGTAAACCCTGATCTACTATTCCATACGC
ATCGTTCAAATCCATGACAAACATGCTCTTGCACTGTTCCTTATTCTTTGCGACGAATAGGTCATCGACGTAGACGAGTACATTCAGGAGTGTCTCACCC
TTTAAACGATAGTATAGACAAGTTTCCACCAAGAATTGCTGGAATGCATGACCTCGCAACCACAGATTTATCTCGGAGTTCCAATCTCGCCCAGACTGTC
GCAGTCCATATAGTGCTTCAAAAATAACGGATATGTATTCATCGTTGGTGCACGGGTGCCCATCAATTGATTGTAAGTACTGTCGAATCCCAAGCGGAGC
ATTTTAATATGCAGTGGAATTATGACATTCGTGCCACTGGTGCAAACGTTTCTATAATGTCAATACCGGCTCTTTGACAGTTTCCCATCGCTGCAATTTG
TCCTTTTAATCTGATCACATAGCGCATTCGATCATACTTGATAACATAGACTCGCATTGTTTTGACTGAATGAGCGTTCGTGAACCTTCTTCTCTTAGAG
TTTCTTTAAGAAGCCTTTTTCTCTGACAGCTGCCATCTCGGTAATTTCGGCCGCTTTGAAGAATTGCTTTCTTGACATATTAAGCTTAAATCATGATAAT
GAGAAAACAGTAGATGATCGTCGGTCATCTAAATATATGAGGTGATTAACGTACCATTTAGCTTAACCCAACATTTAATTTTTGAGTATGAGCATACAGC
TAACTGTTGAGACAGTTACCGTTGCTCAGCAGTGTCGTCGCGCTGGAAACAAAGAGCAAACGTACATTAATGGATGAGTCATTCGAAGAAGATAAAACCG
ATGGAAACTGTATCATCATCGAAAAAGGATGCTTATTAGTGGCTTGAGTGGTAGAAGGGGACAAAAAGAAACGATTTAATGATAGATAAATGAAAAAACT
GATATTGTCGTAGTCGTGTCTATTTTTTACGCAGCGGCGTCCGAGTGATTAACTTGTTGGTCTAATTATGCATTATTGGGTCCCAATTAGATAATAAGCC
GGTGGCGAAACAACAAGTTACGGTGATCGAGTTGTTGTCGATAAAAGTTTAGCTTAATTATAAATGCAGTATCACATTTACC