Description :
From Genome Similarity Track
Location :
Scaffold_161:3184- 4970
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_161-snap-gene-0.16Copper-transporting ATPase

Sequence
1786 bases(100 bases per row)
ATAGGGACATCCAGCCGTTGAGTGTGCAGCACGATCGCCTTGCCGATGCCGTGTTCGCTGCTCTGTTCGGCTGCTGCCATGTAGCTCCAGACCTCGTTCG
TCGCGCCAGCAACCAGCGTCTGCGAGTCGACCACAATGTTCTCGACAGACAAGTTCGCCGATGTGAGCGTGCCAGTCTTGTCAAACATGACGACATCGAT
TCCTTCGAGAGCTTCCAAAGCTTGGCCGCCCTTGAATAGCACGCCGTAGTGAGACCCAATCGTCGTGCCAACCAAAATGGCTGTCGGAACAGCCAAGCTG
ATGGCACACGGACAGCTGATCACCAAGATCGTGATGGCAAAGCGCAGCGCGAACGGGAACGGTGCCCAACCTTGTGTATCGATAGCCTCCTCGCGCGCGA
GATGATACCACACGAAGAACATGCCCACCGCCATGAGGATGATGAAGGTCGTAAAGTACGACGCCACTCCGTCCGCAATGCTCTGGTTGACGCATTTCGA
CGACTGCGCCTCGTCAACCAGGTTCACAATCCGCGCGAGCATCGACTCGGTCACCGTGTGGGTCACACGCATGACGAGCACTCCCTGCGAGTTCACGGTG
CCGCCGATGACAGTCGACCCCGGCTCTTTTGCCACCTTGCGAGATTCACCCGTGAGCATGGATTCGTCCACACTGCTCGCACCTTCGACGACGATGCCAT
CCGTCGGGATACGTGCGCCAGGGACGACCTTCAGAAGGTCTTGACGCTCAACGAGCACGATATCGATGTAGGTCTCCTTGAGCTCGCTCTTCCCGTGGCG
CGAGTTCCCGTTCAGATTCTCGTTTTGTTCGAGTAGAATCGCTGTCTTGGCTTGAATGCGAAGCAGCGCGTCGACACTACTGGACGCCTTGGCCTTGACG
AGCTTCTCGATGTACCGTCCCAACAAGATCAGCGTGATCAGCATGGCAGTGACCTCGAAGAACGTGTCAGATCGATGCAGCGTCAAGTTGAACACTTCCA
TCGCGATCGTCAAAACGGAGAACGCGTACGCCGTGAACGAGCTGAGCGAAATGAGCACGTCCATGGTCACGCGCGAGCTATGACGAATTGCAGAGTATGC
ACTTTCGTGAATCGAGGCGGCGATCCAAAACTCAATCGGAGTCGCGCAAATCAAGCCGACAGCGTCACGGATGGTCAAGCCGCTGACAATCTCCGTCTGG
ACAGGATTCGCATCAGCCGCAAAGAACAGGGGCAAAACAAACTCCATGATCACCACAGGAAGAGTCAATGTGCAGCTCCATGCGAGCAGCTTCGTGAACT
TCCGGACGTCGTCTTCACCGATTTCGGTCGCCTTCGGACGCGGACTGGTCGCCTGCACTTGGAAGCCCAGCTTCGCGGACAGTCCATGAACAATTGAGCG
TGCTCCAGTTGCAACCGGGTCGTACTCGACCAGTAGCGCCTTCTTGTCGCCTCCCCGACTCGAAGTGAACCATGATCGACCCGTCGACGACGACGATGAT
CTCGATGTTGCCAGAGAAGGATCGTCGATGATCGTGACGTTGGCTATTCCGCTGTGAGCTTCGAGAAGCTCCTTTGCATGCACGGGATTCGCTCGGTCAA
TGAGCAGGACGATCGATACGTTCTCGTCATTCGGCACCAGCGCTGGCTTGAACCCGAGTCCCGTGACCATGTTCTCAATCTCGTGCGGCGTCACCACTCG
CGGATCGTACGTGAACACACCGCGACTGGTGAGTAGACTCACATTTGCCTCGGCGATACCAGGCTTGCGCAGCATAAAGCTCTCGA