Description :
From Genome Similarity Track
Location :
Scaffold_903:3184- 13540
Transcript NameFunction/comments
Phypl_g11552hypothetical protein
Phypl_g11553conserved hypothetical protein
Phypl_g11554hypothetical protein PHYSODRAFT_313225
Phypl_g11555myosin-like protein

Sequence
10356 bases(100 bases per row)
ATCGATGAGCGCCGCCGGGCTGCGCAACTGGCGGTGCGTTGCTCTCCTCGAGCCCACTCGTCTGTATCTATCGCAATGCACGTGTACTGACCTTTATGTC
GCTGTTGACTGGCTGCGTGTTTCGCTTGCAGCGGCGAGATCATCCAGCTGAAAGCCGCGCCTTCGAATGGCGATGTTGGTGACGAAGGCCAACGATCctt
gacagcagcagcgagcatAATAGCATCATCCGCGCATGGATCTAGGACGACTGAACCGTTCTCGGAGGAGCGACTTCCGGTACAGACGAAGGTGCCCCCG
AAGGATGAGTTCGGTCGCGACGTGGGGGTCGtggtcgagaagaagcggcgcaAGGCGTCCAGGGACAGTCGGAAGGAAGGCAAAGTGAGGGAGCGGGAGC
ACAAACACAAGCGTCAGAAGCACAGCCTCCGCCGAGACAGGAGCAGAGATAAATCAAGATCGCCCAGTCCTCAAGGTCGTCTTGTTGGcacaccgccgcc
gccagaTCCGTTCCGTCCGCAGGTACGGCTAGTAGACTCGAACTACGTATAGAGATATCCTGCGACGTAAGCAACTGACTGTTGTAAATGCACTGGCAGC
TGGACGAAAATCGAGCGAGGTGCCCACAGCTCCGCACGAGTCGAAGTTGCaaccgacgcagcagaagccgctcACGTCGTCACGGCCGAAGTCGAAGCCG
CGGAGACGCAAGTCCACACAGCGGCAATCACAATCGACACCGTCATCGAAGATCCTCTCGGAGTCGTAGCAGGAGTCGGGGACGAGACCGAAGTCGAAGC
CGACCATCGCCTCGGTCTCGTCGCAGACGCTCATCGGCCTCAGTAGAGCGAAGATGGACTCACAACGCCTTTGATGATCGCAGTCCGAGCCCACCACGAG
AGGCTGATCCGTTCTATCGGCCGGAGCCGGAGACCTGGGTGTCGCGAGCAGGTGGCGTGTACTTGCCTCGCAAATAGCATCATCCGGAAGCGTCGTATCG
TCTGGAGTCGCTCGACACAAGACAGTCACCACATGAGCACGCTCCTCCGTGACTGGGATGAAGGTGTGTAAGCACGAGCTCTTGATCGACTTGAAATGAC
ACGAATGGTTTCCGGTTTGTTGCTTTGCTCATCGGCTTGACCACCTCTTTACTTCTGCTCGTTCAGGCTCGAAGAGCAAACGCAAGACGCTCCTCGAATG
GGTTTGCAGTCGATTCGATCCGACGCGCGATGGCGGTGGGCTGCTCGAGAGCGAGTGCGGGGCTGACATCGCTCTCTTCCTGCCACGTCTGCTGTCGTGG
ATGCAGAAAACAACTGCAAGTGCTATCTACAGCACCAACCCTTcttgcagcaccacgagTAAGCCAGGGAAAGTAAAGTGCTTTGCGCTCGCGGAACAAG
TGGCTTGTCTTCACGTATTTTTCGGGTCGGCGAATGCACACACGTATTATCGAGAATTCCAGCATGCGGATGGTCTTCAGTTGGTGCTGAAGATCGTGGC
CATTCATGACAATGATCTCCGATCTCAAAAGCCAGTGGTGTCGCTCGCCGACCGTGAGACCTTGTTTCGCATCATACTGCGAATTTCCAAGATGAGTCGG
CAATGCAAGGAGGAGATCAGCTCTCTCGACGGCGAGGTAGCTGTGATTCGCGGGGTTTTGGCCAGTGGCGACATAGGCGATTGGAAAACAGAGTCTCGTG
TGTGGACTCTTTGTCGGGAGGTGCTTCTAGAGCAGCTTGTCGGCAACCCCAACAGTCTCGATCGAGCTCATGAAGCGGTTGTGTTCATGCTGAAGCACTC
CGACGCGCGGCTTCAGCTCTTTGGAGCGCAGGTGCGTTTTTCTTTCATTTATTTTTTTGTTTTATATTACCCGCACATCAAACTGCGCTGAACATCAATC
CTAACATGACAGATTCTCCGAGAGTTAATCTCTGAGAATTCATTCTCCTTTGACTCAGAGTATCGAAAACGGAAGGACTGTGATCTCGTTCCTCTTTGCC
TATCTCTCCTCAATTCGAATGACGTCTATCTCCAGCACGAGagtctcgagcttcttcacgctctATTGCAGTCGAGACATTTACAGGTTTGCCTGCTCAT
TCGTGTGCGTGACATCTTGGTTCAATGTTGCTGATCGAAGTAGTGTTTCAGGACATCATTTGTGAGAAGCTTGTTCGCTTGGTCGGAGACAGCGCCAAGG
CACTGGATGTGTAAGCTCCTACGAACAAGTATCTATCCTGGCATTGATTCCCACGATTTCTGACTTCCGGTAGTATGATTATGGATGTTTACTTCTTTCT
ATGCTCTTAGCAAAGTTGAAGAGCGATTCGCCTCAATCGAAGATACTACAGAGCATGAAACATATGCCCACCTCCGGTCAGCTTTTGCTCAAACATCCCA
AGCCGTCAATGCTCTGATGAACTCGAACCGTAACCTATTGCCGATTCTGGTACGCCGGCACTTCAAAACACGAGTGTCATATATCTAGCTCGTTTCACTA
ATTGTAACTGTGTGAGCAGGTTGATCGGTGTGGTCTGCTTATTCCTTTGGCATTCGTGCTCGTTGTTGAGCGACCTCACTCGCTGAAATGGCATTCCGCC
GCGATTAGTATCCGCTTTATCCTTTCGCACCACCGGGTGAGCACTGTCTTGGTCAGCTTTAAATTGGCATCCGTACTGATCAATGGAATGTCACGTACGT
TGGTACTAGGGGGCGGCTGATTGCATCGCTGAGCTCTTTGAAGTCGCATTGGGGGAGCTTCTTGAATGGAAAGACAAGCgaggagatgacgacgagatgT
TTGCCGAGTTCCTTTTGGGCGATGGtgcccaccagcgccaccttgcTCTCCGATTTTACCAGCGGGGATGGTATCGTCCACTATCCCCGAGAAAGCAGTC
AGAGCAAGCTGGCGTAGATCGCGCCCTCAAAGCCATCGAGCACAGTGTcgagacagcagcacgcgactACGTTCCTGAACTGCAAGTGCAAACGCGAGTG
GGTGAGAACGCCGACGAGAccgaggagatggagatcTTGGAGGTGCAGCGTGagcaccagctgcgcctccagctgcagaaacACTTCGCGCAGTTCCGCC
ACATATCTACATCAGCaacgaccaccaccagcagcaactagAAAGACACAACTAGCACTCTACGTGGAATTAATACTACGCGGATGCCGGCAGTGCCGGC
AGCTCCCTTCTCTTCCCAGCCAAAGCTGTTTAGTTCTCCTCGGGCGTGTAGTGGTCCTCGAGGAAGCGCGagagcgtctgcagctgctcagACACGACCT
TGACCTTCTCGCGGcagatctccacgtccttTTCGGCGCCGTAGGTGCTGCGCGCGAAGGAGCGGTAGTCCGAGACCAGGTGGATGTGGTTGGCTAGCTC
GGTGTGAATCTCCTtgaccagctgcaggaactcggtGCACGCCGCGTtgaaggccagcgacgagctctcCTCAGACGACACGCGCGGATCCATGAGCGAC
ATGgcggtggccgccgtgcgcaGGGCCGTCACCAGTTTCTAGCGGCAGACATCAACCAAATGGCAAAGGTCAGTTTCAATCTGGGAGTCTTATATGCGCA
GGAGACAGCGGGTTCGCGCAGAAATTCCACGGTTGGTAAGCAGGCAGACACACACACCtgttcgacggcgtcgagcgcttgcagcaccgccacgtGCCTC
GAGTTGGACCACGGATCGCTCACTTCGGAGAAGTGCACGCggctgtcgccgtcgccctcCATGGTGTCAACGGCAAAATGCTGTCAAATCGGTTTGAGCA
GGTTTACCTTCTAGAGCCAATATGGGTACAGATAGCGAGTCTGGCGGATCGGAGACCACAACTCGACCTAGCCGATCTGCCACTCCTCTACAGGCATCTT
CAGCTTCCCTATATCATGCGTGTTGCAGCGTTGACTCACGTGGGACTCGGCCGCCATCCGCTGCCGAGGCAGCTTCTGGTGCAATATCAATCAGGGCCGT
CCAAGCTCAAATCCCGCCACTTGGGGTGACGCCATTGAAATACATGTATACCATCCAGAATACCCTGCAATGCGTGGGTGTGCGTGGCTCTCGGTGAGTG
TCGACGAATCCTATCATTGCGATGAGCTCACGTTCGaggcagcgccgccgccgcccacgcgcCGAATCCAGACCAAACGTTACTGTGCTACAGTACTTGG
TGGTCCGTTTGCAAGCATCGGACTTGTGGTTTAGCCCCGAGAGGTGGTGTGCTACGACTCGACTCGCGAGTTACTCGTTGCTTGCTCTCTGCTCTTCGAT
GCGTCGCTCGCGTCGTTTCGCGCAGAAACCGATTGCGGCATACTGTGCATAACACGGCAAATTCAGATCTCGTACTTGTGGCTTTTGGCGATTGTTTGTG
GATGTTGGGAGTACTTAGTACTGGCGAAGTTGATGTTGCCCACGACAGTAGAATCCACAAGCTGCAACATGCGGTACATGCGGTAGAAGCTATGAGAATG
TCATGCCGGGATACTTGGAATGCAGAATTCTGACGCTACTGTAGTTTTACATGAGCCTGGTCTGAACGGGCAAACGTATGCCAAGAGGAGCAATAGAGGT
TGTCGTTGGCCCACCCTCAAGACAGAGACTTTCACTCTACCTGGTGGCAACAGCACAGGAGAATTTGTTGCTCGGATATAATTATGCTTGCTTGAAGGGC
CTCATATTGATACCCACGAAGCAAATATGCAATTAACGTTACTAGAAACGCTAAACCCAAGTAGCTAGGCACTCTTGTGAGCTTGTGGGATACATGTACG
ATACTtgttgcagcagccacaTTTAAGCACCTAGAAAGTGGCATCGTTCCACCCTGCCCTTTCGCAGCGACGGGTTACCCTAGCCGCGGCTGTCTTTTCC
AGTCAAATACAAATGCCAAGTCAAACTCACCACCTAATTAGTAGCTCACCAGGACATATCGCCATTCTCGTTTTATCCCACGGACCGCAACAAGTAGTGA
TCGGACTGGAAGCATGGCGTCCGCAACGGAGCTCTGCGCAGAGAATGAGCGCCTGGCGCGCGAGATCCAAGCGCTGATGAGTACcaacacgacgctggag
aaggagatgctAACGCTGAGCacggagctcgacgagctcgaaaGCCTTGGCAACAAGAAGGTGCggacgctggagcaggagatcaagacggcggacgagg
agctcgcgtCACTGCGCTCACAGTGCCAGTCCATGACGGAGATCATCAAGAACGTGGACGCCGAAAACGAGGTCGAGGTTGAGGAGGAGCCAGTGCCGCT
GCCCGTTAGCCGCAAGCTCTCCTCGGCCTTTAACCACACGATGCAGCGAGCGAGGGGCATGTCGATGCCGCGCCAGAGGCGGTCGTCGACGGTGGAGATG
GTTGCCCACGGCCTCACCAAGGCCGCGAGCTACATGATCCCGCCCACGGCACAGCCCAGTCCCGACGAGCCGCGTCGCGTCAGGATGAGCAAGGACAGCC
CGCCGATCCTGTCGTACGCTAAGGGCACGACCGACTCGTCCAAGAGTCTGCTCTTTGCGGCCCATTCGCACTACGGCAACTTCCGACGGCACAGCGGGCC
GTATCGCAAGAACCGAGAGCCCCCTGTCATGGTGCTCTGAAGAGGGGGCACGCATCGAGAGAGCCCACCTGCACTGATTTCACTATTTAACTACCAGCAG
CCATGCTCCTGCAAGACCACACAGATCACCAACCACCGGCGACCTGCGAGAAAGTCTTTCGAGGTGGTACACTATGCATGTCCATTGTCTACCGTCCCAA
AGTCCAATCAATACAGCACAAGTGCAGCACCCTGTTAGTGCCTGCCGCGGTCCAATATCGTTTGCAATTGTTGTTGTGGTGCTTGTCCCCCCATAACCAA
GTCAGCAAGAGCGAATGGAGCATGGTTGATATGTTTATTATGGATCGTTCCTAGCTAGCTGGTCAACGCACTACTACTAATGGAGGGATAACACGCATGT
CCGAAGCGCCGGGGCGACAGCACGGTAACTGCGggttcgtgctgctcaccGGCGTCTCTTCCGTCTACTTACAGCGCGGTTGCCGACTTCTGGCGCGCCA
ACTTCTGTGCCTTGAGCGAGGCCAGCGTGGGGCGCTCGAATTGGGACTTGCCGAGCTTGCGGTTCACGTAGTACACGCGGCCCGTGGAGCGCGACACCTT
GGCCTCCCAGCCGACAGGCAGAGATACCTCCGGCAAGGCATCCAGGTTGAACGATTCGCGTACGGGGCGGTccgccgtcttcgctgcCGGCTTCAccttc
gcgctcttcgaAGTAACGACCGTCGTAGATGCGACGTTGTCGGACAGGTTCGCGGTCTCATCAGGCTTGCTGTTCGTGCGCTTGCTCCGGTTGTCGTAAA
TACCCTTCACGACCGACATGCGGCCCTTGAGGGTCGACATGGCACCGGTGACGCCCACTTCCATGCTCTTCACGATCGTGTTACGCGTGGTAGAGCTGTT
CGTGGGgctgtcctcgtcatcaATCTCCGAgacgtcgaagccgtcgccgTTTTCGCCCTTCTTGTTAGAGTTCCAGAAGCGTGAGCCCACGCTCATGCTC
GGCATGCGCGGGAAGTGGCGCTCCGACGGACGCGTCTCCGACGAACGGCGGTTGAGATCGTCCGAGCCTGTGAGCGAGTCCATCAGCACGGTCTCGCGag
gcttcttctccttcttggaaCCCAGCGTGCGGAAGATCGACTTTTTTGGCGTGGACTTTTTCTCGGGAACAACTCCGTCCGCGTGAAGCTTAGCTATCTg
gtccgtgagcttcttgttATCGGCCTCGAGGTGCGAgatcttcttgtccttgtcaCGCACAGtgtcctgcagctggcggacCTTGACGTGATTGCCAGCC
GACGAGAACTCCTTGTCGCTCTTGAACTTCTCAATCTCCGCCTTCAAGCCCTTCATCGACACCTTCATATCCTCGTTCTTCTcacgcagcttcttgttct
cgtcCGTGAGCGTCTCGATCATCCCGCCAGCGTCAGCCATTACCACGCTCGAGGCAGCGGATGAGTCagccgtcgccacgctgctgcggcgctgcagctg
ggcattccgctcctgctcttcctgcaaGGCAgacttcagcttctgcagctggtaTGCCATGTCCGCCTCACGACGCTTCTCCTCAAGAGCAGCCAGGTAC
TTCGGCCGCTGGATCGTCATACGAACCACGGCCTGCACACGGATGACCATCGCGCGCATCTTAACGTAACGGTGACGCTTGACAAAGCCACGTACATACC
GTTGGATGATGACAGCGTTGTGGTTGCTCTTGACGTCGGCAGCTACCCTGCGGCCCTGAACGCCTCGCCAGTGAGCTTGTGCCGAAATGAGGCCCTTAAG
GAACGTGTTGTATCTGCGCATGGCGATCACGCACCGAATCACTGATTGCAACTTGATGATCGCTTCCAGTTGTCGGAGGTACTTGATACGCTGCGTGAAC
CCAACCATGACGTTCTGCAGGTACGTAGCCTTGGCGTCCAGAAACTTCTTACGGCGGTCCTCGAGCTCTTCAAGCACACCCAGCTGGAAGTACACGCGGG
TTTTACCCATCTGGTACTGCGTCGGAgactccagcttcagcttaTCCATGAGCAGCTGGCACTTGTCAGCTGCGGTCTCGCCGCCACTCGGCACAAATAG
CCAGAACTTGTCCAAGATTTCCGTGTGCTGCAATCGGTTCGGGTACGCTGCACGCGAGATACGAATGGCCTCAATCACACCAGCACACCGCAACTGAGAT
ACCACCATGGACTGGTCCATAACCGTCGCGCTCTTGATCGGGTTGGGCTTGATGCAACGCACATAGTGCACACGGGTCGAGGTGATGGTTGCCATCAGCT
CTGTCAGACTCTCCTTGAACTGGGTACCGACAGTCGAGATGGACagagcaccaccacgcttTCGACGGCCACCCGACGCCTCAGAAGCAGTCGCCTTAGG
CTCCGGCttcagctcgaagagcttAGCGATGAACGGCTTAGATGAACCACGCATGAGTTCGGACAGGTCTGGCAATAGCGAGTCTTTGTgcttctccaag
aagcccaCCGAGTCATACATGACAGGAGCGGCATAGTGTTTGATGAGGAACTCGGTGCGCGACGTGCGAGGGAACTCAATAACGTGCGCCATATCGTCCT
TGTGGAGGGACGTCACCTTGGACATGAAGGACTCCTCGTTACCCTTCGGCCGCATCACCTCTTCGTTCAGCAGCGAAATTATACCCATGCGCGACTCAAT
CACAGTCAGCACGTCCTGATTATCCGCGTACTCAATGTGGTCCCACACGATgccttcctcctcgtactcgaTTTGCACGGTCTTGAACACATCCTGCGTA
aacttctgctgcagcttctcatTGGCGTAGTTAATGCAGAACTGTTCGAACGAGTTGTGTTTGAAGTGTTCGAAACCGAAGATGTCGAGCACGCCCACGT
GGTTGGCCATGTTGGCATCGTCGGCAAGCGACTGGTTAATCGTTGTCACAAGCCAGTCGAACACGTTGGAGTAGATGGCCTTGGCGAGTGCATCACGACA
GTCCATAGCCAGATCCTTCTTCAGCGGCACGCTGTACACATCGTTCACAGCGCGCATGGTACGCGAACACAATGCAGTCTGAAGTGCCTCCCAGGTGACA
CCAAGCATCTGCGTCGCAGAATTCGCACCGATGTCGCCCTCGGTGATGAGAGACTTCTCGTCATCTGCAGGGTCCGACTGCAGCTGAACCTCACCGAGGT
GAAGCACACCAGCTAGCACTTCAAAGAGCGGTCGCTGGTCATCACGCGACAGACCCACGAGTTCTAGCGCATCGCGCGTCTTGTTGAAGTGTTTCTCATC
AGAGAGGCCTTCAATCTTCTGTGCCGTGTTGTCGCCCGTGTACACATAGTGCTTTGCCGGGTCGAGCAGTAGCTCCGGTGCAATGTCGGAggagtccagc
agctgatAGAAAATGTGGTAGTTGCGCTCGGGTGCTTCGTGTTGGATGACACGCGTCTTCTCTAGCAGGTACGTGCGGCATTTGGCGCCGACGAGCGTAC
CGTTCGTGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAATTGTCGTTACGGACGGTCTTGGCATTACCGAAGGACTCAAGCAGCGGGTTGAC
CTCGATAATCCTCTTGATAGTGGAGTTGTTGAGACCACCGGCAATGGTGGCCAAGTGGTTCATGAGGATCTTGGTGGTCTCCGTCTTACCGGCACCGGAC
TCACCACTGACCAGAATGGACTGGTTCACCTCCGAGCGACGCATGTTGTCGTAGGCGGCGACCGACGTGGCGTACACGTGCGGGGGGAGCTCCTCTTTGG
GCTGGTTGAGGTagcgcaggtgctgctcctcggcgtAGAGGTCCGGGAGCCACTTGTAGGGGTTGACGGCGATACAAATGTCGCCCGTGTACGTGTAGGG
CAGCTCACATaggaagcgcttcttgacgtTGTAGAGGATGGCGGCCTCGTGCAGGTAGTTGAGCATGATCATGTCCTCGATGCCCTCAGGCCCCATGTTC
TCGTTCTGGTAgggcagcgactcgagctggtgcacgtccagcagcgccttggtcttcttggacAGCATGTCCACACAGCGCTCCTCGGTCTCGCCGTCGG
GAAGCTCCACCTTGCAGTAGATCTTCCgcgtcttgccgtcgcccGCATTCTCGTCGCGCAGTACCTCGGCCGCTAGCCACACGTGCGTCTCGTCCGGCAC
GAAGCACTTTGCGCCCACCACCATCTGCAGGTCGCTCATGATGTCGTCAAATCcctcttggcggcggcgtcgtcggtCCCCTTACAACTCAGGAATAGGA
GGAGTAGGTGCGCACGAGGGGTGCCAAAGCGGAATGCGGTCGAGTTGAGCCAAGGGGGGGGATTAGATACCGCGCAGAACCGGTAAGTGGAGCCATCTTG
CGACTGGCAACGCTCTTCTCTTGAGCTTCGTATCTACACCCTCATCTGGCAACTACATAGCCCGGCCAGCGCAGCTGTGGCAACCGGCTGGTATCGCCGG
ACGGCGCGTGAGAGGATTTGACTGCCGAGCAAAGGcccgcggcgctggcggcacgGCCAACGTGCCGCGCAGTAACCATGGCCACGTGCCACCTTAGGCC
GCAGCATCACGGTGCGAGCCTTCACGTGGCGCAAGTATCGCACAAAAAGCTTCTCCGCGTAACGCGCCCCGCTGCCCCACTGCGACGACGGTCGTTTTCT
GCAACGCACATGATTTACCGCCAAAAATCGGTTCTCATGAACTTTTCAAAGCGCAT