Description :
From Genome Similarity Track
Location :
Scaffold_1826:3184- 4188
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1826-snap-gene-0.1Inositol-3,4-bisphosphate 4-phosphatase

Sequence
1004 bases(100 bases per row)
GTCCGTGCTCTTCACGCAGGGGATCAACGAGATGCAGAGCCTGGCCAACATGGTGGGCCACTCGGGCGTGTCGATCCAGAACAAGATCAACAGCACGAGC
TTCCGGTCGATCGTGGAGTACTACAACCGCGTGACGTCCAGCGGCGTGGCGCTCTCCGAGACGAGCGTGGGCTCACACCCGGACGAGATCCTGCGCAACC
TGCGCGTGAGCGTCGAGGGCGAGAGCTCGTCGAGCAAGAACACGTGCATCCTGCTGCACGCGAGCGACGCCGTGCGCAGCTTGAACGGAGGCCGCGTGAC
GTACTGCAAGTCGGGCAAGGACCGCACGGCCATGAGCGCCACACTCGAGCAGGCGCGGCTGCTGGTGCAGCGCAAGCGCCACGTGCTCGAAGAGATCGAG
AACGGTGGCAGTACGGAGTTCGGGCCGCTCGAGGAGGTCAAGAGCGTGGCTAACGTCCTGCGCGAGTTCGGCGTGCGCATGGAGATCGCGCGCAAGAACG
TCGGGCGCGCCAAGTACTCGTTCAACGCCATCCAGCGCAAGCTGCTGCCCGAGATCTACCGGCCGCCCGTGGGCACGATCCAGGACATCGTCACGTCCGT
CACGGCGCGCGACTCGTAGGCCGAAAAGAGTGTGGGTTGTGTGAATGGAATGGAATGGAATGCTTGGCTTGTTATTAATCTCCGTAGTCATAATTGGTAC
TCACTCAACAATGAGGTTTAGCTGAAGGTGCCCGAGTTCGTTGTGGTCCAGAATCGTGGACTGGACATCAGCGACGATCTGCTCAAGGAGCTCGCGTGAC
GCCGCAACGACCTCAATGCGCTTCGCTCGCAAAAGGCGACTCGGTGAACACGCGAAGACGCAGTCGAGAGGGTTTACGTGCTCCTTCCGCGTGGCTTGTT
GCATCGTGTCGCAGAGGGCGACAGACTCGAGAGGGTTGGACAAGTTGTTCACGTGAATGCATCCTCTCACCAGCGCATCCTGTGTCTGCTGGGACTTGGC
TTCG