Description :
From Genome Similarity Track
Location :
Scaffold_280:31832- 33141
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_280-fgenesh-gene-0.7ATP-binding Cassette (ABC) Superfamily

Sequence
1309 bases(100 bases per row)
AGGCCGAACCAGCCAGGGCTTGGCTTGCCCTGCACCTCACCGAAGTACAGCGAGAATGTGAAGCGCATGCGCTCCACCTCGGCACGGTCCTCCATGAACT
TTGGGAACTCCGCGACGTTAGCCTCTGGAATGGTCCACGTGAACTTGTTGCCACCAAGTGGAGGAGCAACATCCTTGCGCACCGAGCGACCAGCCATCGA
CGTGCTCTGCGTCTGCTTGGAGATGACCCAGTTCATGAAGAGCTTGGCAGCCGCTGGGTGCTTGGCCTTCTtGAAAaTGGCGAGACGCTGGCCCCAGCCA
AGGAATGGCACGCCGTTGCCGTAGACTGGCTTGATGGTCGTGGTGTTCGATGGCGCAAGCGAGATGGAGGCACCGACGCCAACGATCTtACGCTtAGCAC
GCACGGCCTCACCAGGCGTGTTGGTGCCaCGGTTGAACTCGACCTGCTGAGCCGCGAACTTCTCGgCCcATtCCCATCCGTACTTCTTCACGTACTGGGT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCcAGCGAGGgAAGTTGTTCAGCGTCTGgAGCATCGCAATGTCCGGTACGAGGCGATCGCGCGCGAGCTGGTTGTTGATAC
GGACATCGTGGAATTTGGAGTAGTCGACGACAATCGTCAAGTTCACATCCGGGTAAGCAGCCTTCCAGGCGTTGCGGATGCCGTCCTGCTGGTTGTCGAG
GTCGCCACCAGCGTAGATGACAAGGTTGCCACCTTCCTTGAGGGCTTCCGCGTGGAGTTGCTCAAGGGTCTTGGTCTCTTCCGAGATGGCGTGCACCTGG
GCCACCGAAATGGAGGCGACAAAGGCGCCGACGGTCGCGAGGAGGCTGAAGAGCTTCATCGTTGGGTGAAGGCCGCTTGTGATGAGGCGAGGAGATTCGA
GAATGAGAC