Description :
From Genome Similarity Track
Location :
Scaffold_330:31825- 32958
Transcript NameFunction/comments
Phyta_totarag7202hypothetical protein

Sequence
1133 bases(100 bases per row)
TTAACCTTCTCGCGGTAAAAGGCTACATTTATCGCCCTTTTATACCCTTCTCAAAACACGGTGCTAAATGGCTCTCTAAAAGGGCGCCTCAGGCGCCCTT
TTAGCGTTGGAGCCGGTTTTAGCTATCGTGTTTTGTTACTACCAATCAAAACACTGAAGCTAAACGAGGATAGGTTTATGATTCGGATGTCATTCGAAAA
AACCCCGCGCTAGCCGTAATATATGGTGCCACGTGGCCTGCATCACCTGGATTGAAGCAGAAACGGGGAATTCTCATCTCACATTGTATCCTGACTGCTC
CATTCTGGTCAGTCGTTTGCCTATTCAAACCGCCAGTAGTATGCACCTTCGGGAGTCAGCGCTACCATAACTAAATCAAGTCAGATGCAGTTCCTCCAGC
ATGCGCACTAGTTTCCAGGATTGTAAAGACAAGCAGCTAGTGCAAATTGCGCTACAGTTCGAGATAGAGGGCATCCGGGTGACATGGGACTACGTTGCAC
GCCGAATGGCGAAGTCGAAGCGGACAGCACGCCAGTTCCAGCTACGTCTGACTAGTCTCAAGCGAATCTATGGCAAAACTGTCAGTAACTTCCCCCAATG
CTTCTTTTCGGGGGCTACGCGAGTGCGGCCCGTGCTGCCATCGGGGCCAGCGACTTCGCGACGGCTGCCTCGCGCAGTGACACTTCGACTACTTTTGGTT
CCAGTcccagcgtcagcgtcggTCCGTCCTGCGCAGCGACCGGCGGCGAAGGTGCCTGCCGCAGCACCGTTGGGTCCGCCCGTGGACTatgcagcgcaag
cagcagtggcgcgGTCGGCAGGATTCGCAGTGGTAGAGCCGTTAGCACCAGCACTGGTAGTCGAGCGGCCAGCTCAAGGCCCGTTCCTAGAGCGGCTCAT
GCTGGCCGAAGCGACGCGCGCTATCTCGTTGGTATTTGGAGATATTAGTGCGGGTGACGTTCGCCAACAGGTCGGGCGAACGCACAACAATTCGGGGGAG
CTACTACCGCCAGGCATTGCAGCGATGATTGAAGCGATCGGGCCATTCGACGAGCATGACGTCTTCCTTGACGTGGGCTCCGGCATTGGCAACGTTTTGG
TGCAAGTTGCGCTAACGACTAGCGTCAGCAAGT