Description :
From Genome Similarity Track
Location :
Scaffold_426:31824- 34295
Transcript NameFunction/comments
Phypl_g8197PREDICTED: copia proteinlike putative

Sequence
2471 bases(100 bases per row)
CATGCGGCGCTAGTGAACGCCGACGCCTACGGGCGTcaccagctgctccaggagTGGACCAAACCGGAGCCAGCTACACCACAACGGCCACTTCAGCGGC
CAGGAGACCAAACGTTCATATCGCAAAACGTACGAGGATTCAAGGATAGTACTCGAACCAACTGGATGTCGGCGTGGAGACGTCAACCTGAGAGAACCCG
CCCCCAAGCGTGGTGTCTCCAAGAAACCCACGTCGATgcggaagaggaggcgaTGGCGCTGACGGCCACATGGGCCAGGATGTGGGGAAAGCTCCACGAC
CCCGACTCCCCTGTCCTCTCCTATTGGAGCACGGGGTCCTCTAAGGCGGGGGGCGTGGCAATTTTGCTGACTCCAAACAGCGCAGTCCCCACGAAAGCTT
GGCAGCGAGGGCGCTGGAGCACGCGAATGATGGCAGTCGCCATCAACGGAGTCAAGTTAGTCAATGTGTATGCCCCGAACATACGGGAGCAACGGGAGGC
ATTCTTTACGGGTCTGATCGCCTGGAATCTGCCACGACAATAGACCATGCTTACTGGTGATTTCAACAGTGTCCAAAGCCCTTTACTAGACCGACTCGAC
CATCAGCGTTCCAGCAGACCAGAGAGCCCAGCTTCGGCAACCCTGACAGAATCCGCAGGACTCGCCGACGCACGGCTTCTACGGGACCACGCCGAAaatg
aagaaggagatgaaaCCCTGGACCACTTCATGTACTGGGCGGGGGAGCGGGCTAGCCGAATCGACCGGTTCTACGTCCCGGAAGATGGACGGAGCGGGTC
CAATGGGTAGCCGCGCACTCACCGCCTCAGCAATCTGACCACCAGGAACTGGAACTGCACCTCCGTGATGGAGAACGCATCCATCAAGACCCGCAGCAAC
GAACCGTGACGTATCCCATCCGTACTAACCAACCAGAACGAGTTATTGCTGACCTGGTGGGCGAGTTAGACGGAATGGCCGTCGGTCAGATGGCGCCGGT
TCGAACCTGGGGTGCAGAAGTATCAGAATGCACGCGGTGTACCAGAGCCGTCCGAAAGAGAGAAAGACAGCGCCGCTACAGATTCAAACAAAACCTTCAG
CAACGTATGATACGCCAGCTCCTCACTAGGCGCCAGTGGATAGAGGCAAAtatggaggagctgcgtcaaGAGCACCTGGTGCGACTTGgacagcgtctcc
accggACTACCGAGAGCCTTCGTTGGTCTTTCAAACGTGTAActcgaagatgaagctgctaGAAGACCGCGCGCTGTGCGTCATCGACCTGAACTGGAAG
AAGCCAGTGCGCCGAACGACTCCTCNTCATCGACCTGGACTGGAAGAAGCCAGTGCGCCGAACGACTCCTCTTCGCAccgagcagacgcagacgacgaag
aaaagTCTGGAGACCAAGATGAAGAATCGACTCCACCTATGTTTTGGCGTGCAAGTGCCAACGCGGTCGAAGCAGCAGACCTATCGGAGCCGACGACGTT
TCAAGAGGCGGTCAACGGCCCTGATCAAGTGCACTGGCGCAAAGCGATTCGCGCGGAACTCAAGTCAATGCAACTGCGTGGTGTATTTCGAGCTGCCAAG
TTGCCCAACGGACAGCGCGCCATCGGCACCAAGTGGGTGTTCAAGATCAAGCGCAAAGCGGACGGATCGATCGAGAAGTACAAGGCGCgcctcgtggcca
agggTTTCAAGCAGAAGTACGGCATCGACTACACTGAGACGTTCTCGCCCGTGGTCAAGTACGTGACGCTGCGCATGGTCATCGCGATCGCCAAGTTNCT
GGATGGTGACTTCGACTGCCTGGAATTGGTGAAGGCGATCTACGGTCTCAAGCAAGCTTCGCGCGTGTGGAACGAGACCTTTGACGAGTTCGTATGCTCT
ATCGGCTTTCAAGTTTCGGCCTTCGACCCATGCCTCTACATCAAGGTTGTCGATGGCCACTGTGTGCTCGTGCTAGTCTACGTGGACGATGTATTGGTCA
CTGGAAGTTCACCCGAGCTAATTTCACGCACGAAGAACGACCTCAAGACACGCTTCGAAATGACTGACAGCGGCAAGTGTGTGTTCGTCCTTGGgatcga
gctggtggacggccCGGACGGCAGCGTGACGATGTGCCAGCGCCGTTATGTGGACGACATTCTCAAGCGTTTCGGTATGGACGAGTGCAAGGCTGTGGGA
AGTCCGGTGGATATGAGCTCTCGACTGGTTCCAAGCGACGCAGCGACCAAGGTGAATGCTCCGTTTCGCGAAGCGGTTGGTGCCCTGATGCACCTCATGA
CTGCGACGCGCCCGGACATTGCGTACGCCGTGGGCTATGTGTCGCGCTTCATGGAGAAcccccaagaagaacacTGGATTGCGGTCAAGCGCATCTTTCG
CTATCTGCAAGGCACCAAGATGCATGGGATCTGTTTCAAGTCGGGTGACAAGATCGATTTTCGTGGGTACT