Description :
From Genome Similarity Track
Location :
Scaffold_7:3182- 4501
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G003504Similar to USP15: Ubiquitin carboxyl-terminal hydrolase 15 (Homo sapiens)

Sequence
1319 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCACCGAGAATAGCAGTGGTATCAACATCTTGTCTCCGCAAAGTCGCGCGTTCCTGG
CGCGGTTGCCTTCCTTTTCGTCACGTACGCGAGAAAACGACGGCGGCACTTCGACCGCGAGTCCTGAGACGTCCATGAGTGCCGCTGCAGCTACAAGCCT
GCGCTTCCAAGTACGCGATAGCGATGGCCGGCCCGACGCCGAGGTCGCGCGCGAGTGGTGGATCACGCACCTTCTCAATGAGCCATCGATCTGCTCGGCG
CTATTTTGCGGCCAGTTCAAGAGCGTGCTCATGTGCGACGTGTGCGGCGCGACGTCGGCACGGTTCGAGTCCTTTGCCTCGCTCCAGCTCCCGCTTGTTG
GTTGTACAGACCGAGAAAA