Description :
From Genome Similarity Track
Location :
Scaffold_1287:3181- 7237
Transcript NameFunction/comments
Phyta_totarag12633hypothetical protein

Sequence
4056 bases(100 bases per row)
CCATTCCTCCTGATCTTGTCGCCTCCCCACAGACCCTTCTTCCAACTCCTCGCAGAGTGGCATGTCCACCTGCGATCTCGCAATCTTACTGCTGCTCATG
AGACTGCATGACGCTGAACCGGTTGCAGTTGGACTGCTCGCGCAGATAATCACACATCTGTGCTCCACAATTGAGATCAGCTTCATCAACCCACGTGAGC
TCCTCATAGCCTTTCCAGTGCACCAAGAATTCTCGCAACAGTCGCCCATACCGCGTGCGACGACCAGATCGCATATCCACAATCTTGTCCACCTCGAATT
CACCATCCTCTAGCTCGTTCTCCCAACTGTCCTcagacagcagcgcttcgtcAAAGTCGAATCGATCTTGATCTCGGACGACTAGATCCATTCGTGGGCG
GTCGGGGAACCGTCGgagcaacttcagcttcgacacaTGCACCACTGGGAACAACCGGTACTCTGTCCCAGTTATTTCGAGTCGAACAGCGTACTCgtcc
accatctccaccactcTGAACGGCCCATGCCACATATGCGCCAACTTGCGTGCGTAACcttccttcaccttgtcgaGGTATTGCCAGACTTGAGAACCGG
TTTGGACCTCATGCGGACGTACGTCGTGGTTGTGTCGGTCAGCTCGATCCTGGATGGTTTCTCTCAATTGGTCGTTCACTTGCTTCCGCGCTTGTTGATA
GAGTTTCTGGATGTGGTATCGCCATCTCCTCGGGTCACGATCTCGGTGACGCGTCGATCCCAGTGGTATCATCGCTTCCAGTGTAGATCGCGGGTCCCAG
CCATGAGCCAGATAGAAGGGTGTATTTCCACGcactcgatcttgagcggtgttgatggcgaacgTCAGGCATTCCGCATACTCCTCACAATCCTTATGGT
CTACATCTGCGACGTACATCTTTAACGCCCGAGCTAGTGTCTGCACCATCCGCTCAGCCGTTCCGTTGGCCTGTGGGCGGTACGCCATCGTTGCGTGCTG
TTTTTGGCCGACAATCTTATTGAACGATCTAAAGAAGTTCGACATAAACCCGGGTTCTCGATCATGGCGGATTGCTTCACTCGCGCCGAAACGTCGGAAA
ACGCACTCTTCCTAGTTCTCCGCAATTGTCTGTGCCGTCCTGGAGGCGCTAGCTTTGGCGATTACAAATCCGGTGAAGAGGTTGACCCAGATCAGCAACT
CGGTATTGCCCTTATGAGATCGAGGTAACGATGGGATGTGATCCATCGCGATGATCTGAAACGGGTAGGCCGCCTGCAAATTACCCGGTGATTCGCCTCG
GATAACAGGTCTTCCCTTCCCCGTCTCACAATCCACATATCGCCTCACATATCGCTGCACTCTAAAGATTCCTCTCCAGTGAAAATGTGCTCACAGTCGC
TGGTAAGTCCGTCCGACTACTTGATGTCCTCCTTCCAAGCTGACGTGGTAATGATGCAGGAAATCCTTCTGCAGGGTCTCCGGGACGACCAATCGAGCGA
TAAGATCACGATCTTGACGCGACTGCGTTGATGGCGGGCAGTAGAAAAGCAACCCATCTTCGTCGATTTCATAGTCTTCCGCGATCTTGACGCAGGTTTT
TGCTTCTGTCGAGCTGAGATCTTGTACGTCCCCTCGCAGGTAGTTCTTGAGATCGCCAATCCATTTTTCTTCGTTGTGCGCTCGAAGAACACGTTCGGCC
CTCAACTGCTGGACGATCTCCTCATTCAGGACTTCGGGACTGCGTCGCTTGCGTGATCTGGTTACAGCCGAGATCTTCATGGTAGAATTCCTCGTTTGTG
GaaccagcaacttgctctgTCAATTTAGTGTCCTCAAATCTTGGCGCTCGATCTCAGTCGTAACCACGTCACCCCCTTCACGTTGGAGCGCCGCACCGGC
TAGTCGGTCGGCACTTTGGTTCCAGTCTCTCTTCATTTGGAGGAACTCGTGGCGCGGCCAAGATCGCAGACGTTCCATCGCTCTCTCACGCAACAAGTTT
AGCCCTGGTGCTTTACACTCGATTTCGCCGCGCATTTGTCGAATCACCAAATTTGAATGTCCACATATAATCAGCCGTCCCCTGTCCAAGTTGGACAGGA
GATCGAAACACAGGAGCAAACTCCGCCTCATTTACGGTAAGATTGACCTTGTACTCAGACGTGGCCAAGATCACTGTCCATTCTGGTAGACACCACACAA
TTGCTCCATAcactcctccacctcgctTCGCACGTGCCGATCCGTCCAAACTTACTACAAACAGCTTTGCTTCGGGTTCCACCGTGGGAGGGGGCATCGA
GATCACTTGACGAGGTTCCTTTCGTGGTGCGATCGCCGTCAAGATcgcgtcaacttcttctcggGGAGTGATGCTTGCCGCTACCACACCCAAGATTTCA
TCCTCGCCCTTCGTGCACTTGACGATCTCCAACGTCCAGCTAGAAAGAAGTGCGGCCCACCTGCCCAAGCATCCCTGCAAGCCCGATGATTGAACCAGCC
AGGCTAACGTGGAATGCCGAGTTAACACCTTGATTGGTCGGGTCACCAGTTGGGTGTAACATGAATTCAGCATCctgagcagcgccagcacttCTTTGTT
CACGATACCGTAATTGATCTCGTTAGGCTTCAACGTGCGACTGGTAAATGTCACCGGCTTGTATATCCCGTCATGCTCCTGCACCAAAGCTGCCGAGATC
GCCCACTTACTCGCGTAGACTATGATCACCGGTCGTCGGTGGGTCGAAGTGTTGAAGGATAGGTGCTGTAGCAATTATATTCTTCAGGGTAGCAATTGCC
ACACCCACCCGGTCCCATTTCCCTCTTCGTTGGGTTGAGCTTCGTCTTTGTTTCCCAGATCGCGCCTGGGCGCCTTCAGGTCACGCTTGGATTTCCTCGA
GATCTCGTAAAAGTCGGCCTCCCGGAGTTCATATAAGACCGACGCGTCGATCGCTAGATCTTCAATGAAGCGGCTGTAATAGTTGAGGCTGCCCAAGAAA
GACTGCATCGATCTCAATGTTGTGGGGAACGGTAGATCAACCAACGACGACAGGTCCTTCGGGTGAGCCTCCAAACCCTCGATCGGTATTTGATGTCCGA
GGTAGTCCACTTTTCGCAAGCCCCAAAAGCTCTTGGCGACGCTGATCGACAAATTCCACTGATCGCACGcgtccagcaacttgtcgaCCTTGGCACATAA
TTTATCCCACGTATTGGACGTCACCAGGATATCGTCGATATAAGATCGGCGACCGATAACAGACGATTCCTTCTCCGTGTCTGACACTCCCTCCTTGAAC
AGGTCGATCTGGCGAGGACGGCCAGGGTCGTTCGTAATCTTGAGGAAGCCGTACAGAGCGTTATCCAACAGTCTCTGGTAGATCTGCGGCGCGTTCTTCA
ATCCGAAGGCCATTCGGTTCCACTCAAACAGGCCAAACGGAGTAATGAACGCTGAGGTCGCGCGGGCCCGATCCGTCATAGACACGACCCAAAACCCACT
GGCCATGTCTAGTGAACAGTACCAAAACATCTTGTCGAGATCGTCGAGCAGATCGATGATCAGCGGCATGGGGTACACCATCAGTCGCGTCAGGCTGTTG
ACCAACCGATAATCGATGCATATCCTGATGTCAATTCCGCTCATCTTGATGATGATCACAATCGGTGAGACCCAGGGTGAAGTTGAGTGTCGGGTGATCT
CCGCAGACAGCAGGCCCTTGATCAGCTGAAACAATTTTTCGCGGAACTGCAGGACGACTTTTCGCACCCGCTGGGAGACGGGTTTAGCACATTCCACGTC
TATGTCGCATATCGCTCCTTTCGCAGCTGGCGGTAAGGCGTTACCTTTCCCAATTAAGAGATGTCGGCGACGCCAGATAATCTGTCGTAGTCGTTCAATC
TCCTCCGGCGTGTTGTCGCTGAGATCACCTACCTGAATGTCTTCTATCTTGGCTTCCTCTGTCATTGCCGTAATTTCTGGTAACACTGCCATCTGCcctt
cgacgtcttcagtGAACAACTCCCTTCCTTCCTTGAAGCATACTTGCTCATCTTCG