Description :
From Genome Similarity Track
Location :
Scaffold_445:3181- 4711
Sequence
1530 bases(100 bases per row)
TATCTGGCAGCCTAATTTACGAGCAAGGCGGTATCCAGGATGCATTTTTGGCACCAGTACCAAACAGATTTTTGAGCAATCATTGTTGATCTTTCCAGAA
GCTTAATCTTGTCTAAACCATCGAAGAAGCAATATATTTCCAGTACCCTTGGATTCGCCCGGCAATAAGTCTAACTCCATCACTGCGCTTTCTCGAGAAA
ATTCATTAGGCTCATCAATAAAAGCAACATGGATCACACATTATTTTCCAACCTTCGATATATTTTCAATTGTCTTAGGTGGATTACCCATCTCGTCTTT
GGTCTGGATTACACATACGCGAAGACACAACATTTGAGCACTCGGCTCGTACCAGATTCAAATCTGGCGAGAGTTCTAATTTACTATCTTCTCGGCCTTC
TCCGGCAACATTTAAGCGTGCATGTCGGGGTTTACCATTGACGAATCGAGTTGTAGAACTTTACCATCCGGCACTTCCCGAAATCATGGGTCTCTCCACA
ATCTCGGTACACAAACAAAAATCGGCCCGATATGTGACCTTTCTTTACACAGAGGTAACACTTCATTCGCTTTCAACATTTCAAGTGTTCATGATTACTA
ATACCACAGTGGGCACGTCTCGTGTTAGGAGCGGACGTCGAATCGCGGGGTCCCAGGTTCCTTGCCTAGTGTCGATGCTGGTAAACCTCCTTGGTAGGTC
GGTTCCTCATAATCCTCGTACCTGGGTACTTGCCCGCATAGCTTCCATCATACAGACTCGCCTTAAGCACCCTTCATTGTCCGCATTTTCGTGCTGGAGT
CCTCGGAGCTTGATTCTTCCGGGTCATCCGAATTGCGTGCACAGAGCGGCGTTCATCTCTCGCGGTCAGTCAGGTGAGGTGGGTGCCTCCTGATAAACTT
GCTTCATCAAAAAAGAACTTGCCTCGTCGCGCCTTCGTCCGCTGGCGTGCTTATAGCACGTCCTGCAGTCCGTCCACATCCTCCAGACGTAGCATAATCA
ACTTGTCCTCTATCCCTAGGTCGTCCAAATTTTTAATATAATTTATCGACATGTTCGTTTAGAATCTTTGGCGGTCTATCTTTATCTTTAACTTTGCCCT
GAGTCCAATCACATTGAGACGGAATAGATAGTACAACGGGGATTCATCCGACCTCTTCCTTTGTAAGGTGGTACTGATGACCGACTGGTACTCTCAAACC
ACAGAACCCCATCTTTTTTGTAATAAATACTTTCAACTCCCTCGAATGAAGCGACCTAGTTGGCGAAACCAATTCAGCGCTGGTCCGGTCAGAATTTTCT
AAAACCAAGACACTTTTCTCCGCCTGGTGCTTAATCTCTCGTGATTGCAGTCTTTACGGTATTATTCAGCTGTGTGCTCGGTCCTCGTCTTGATCTCTCC
CACGAAACTGCTTTATTATATGAGGTCATCAAGAGCTTAATACGGGTGACCAATTGAGTGCCTGTACCAGTGTGTCATTATCCATCCTCGCCGATGGTTT
TTAAGGTCCGGGTCATCCGGACCGTTCTCG