Description :
From Genome Similarity Track
Location :
Scaffold_107:31801- 42017
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_13796conserved unknown protein
Sappa_CBS223.65SPRG_13797Hypothetical protein
Sappa_CBS223.65SPRG_13798Annexin (Annexin) Family
Sappa_CBS223.65SPRG_13799glycoside hydrolase family 5 protein
Sappa_CBS223.65SPRG_13801conserved unknown protein

Sequence
10216 bases(100 bases per row)
GAAAGGAGGAGAGAGATGGGTACGTTGTTGTGCAGTCGAGACCACTGTTCGTCGAATCAACGAGCAGTTGATCAACGATGGACAAGTGCCCGTGGGCAGC
CGCGAGATGCAGCGGTAGATTGCCTCGCTAGATAGCATGGGATATGAAAGGCCAGCTTTGTATAGAGGCAGGGAATACATGGTCGCTGTGCAGAGAGAGG
GAGGGGTCCTTTGCCAGCAGCAGCGAGGTGATGGTGTCGTAGCCGTTGACAGCTGCCACAAGCAGTGCAGTGGCTCCGTCCTATGGATGCGGAAATTGCG
TCAAACGTTCTCCAAAAGAATCTGCGAACGTCGTACCTCATTGGTGGTCGAAGAGCAAACCCCGGCACGAAGCAGGTTCTCGACGTTGCTTGTGTTGTTG
GTGGACGCAGCTTGGAGCAGCAGCTATCCAAAGCCATACATTTGAACGGCCAAGCCCTAGAGAACGTGTATCCTGTGCGAACACAACGGAGGAGGCAGCT
CGAGGATACCTCTTCGCTCATCAAGGCCACACGCGCGTTGGCTTTCAAAAGGGCAACAACCGCAGCAATGTCGTTCTTGGCCATCGCACAGGCAAGCGCC
GTTTGCTCGTCCTACGATATACTATTTCGTGTGTGCTGGCTGCGTGTTGTGTACCTTGTCAGTCGCGTTCACATCGAGGTGGGGCTTGGCCAAGAGAGTT
TGCAGTAGCTCTATGTCACCCGTGTCGACCACCAAATGCAGCAGTGGGACAAAATACTACAAGAATAGGATCATGAGTACTAGTACGTTGCTTGCGATGC
AGTTGACGTACGCCGTCTCGCAGATTCACGTCGGTATGGGGCTCCTTGATGAGCTGGATGGCGTCTTGGATGCGTCTTTCGTGCAAGGCTGCGAGAAGCT
ACTCATGGGAACGTCGATCGATGACGTCGAATGTGTTGATGTACATTGTTGATCTTGCGTTGAATATGGTCGCGCAAGAGCTGTGCCATTTCATTGCGGT
TCTTTTCGACCGCAAGATCGAGCGCGGTCTTGTTGTCCTACGTTTTTTTGTTGTTAAAAAACGATTTAGTACGATATGTACCAACAACGTACGTTGTTTC
TGGCGTTGATATTCGCGTTGGCGGCCAAGAGAAGGCGTGCAACTTCGAGATAATTCAAGTACGCCGCGCAAATGAGAGGTGTATCTCCATCCTACCGATT
GTCAAATTTCATTCGGGATCAAAAAATTCAATCAAAAAGAGAGTCGACGTACAAGAACACGATATTCCGTCGACACATTCTTCGTCAGCAAGTAGTTGAC
GACGTTCGTTCGACCATTCAAGGCAGCAGTGTACAATGCATACTACCACCAATATTATACAAATAGATACCTAGAATAATAGTAGACGACGTACGCCATT
GTCGTAGTTGGGATTCACGTTTTCTTCTTCCACGAGCCGCGTCACGTTGTCGAGTCGACCATTAGCTGCAGCAAATCGGAGCTTCTCCTATGTAGTCAGA
GACGCAGTCGATCGCTTCCTTCTTCTTCATCTTCTACTACCTCCATGTGGCTCATGGTCCTCTCGGCCGCTGACGTCCAAACCGAAAATGATCAAGTGAG
TTACCCCTTCCAATCACATACCGCCATTTCAGCATCTCGCGTCCGATTGGCCAAAATACAAATACAGCGAACAACATATTTGCACGTTCGTGAAGAAGCA
TTATAACTCAGTTCACCAACAAGCAGTACATACTGACGGCCGTGAGGCAATTTCTTTCCCCGACATAGATTCTGAGAGGCTCAGCACACCACTTCTCGGA
GTTTATAGTTGTTGACAGGTAATAACAATCATATCTCAATAGACTCATTTCAACAACCAACAAGCAGTACATGCATCTGTGCAAGTACGTCGATTCCTCG
ATCACCCGCCACACTGCGATCTTCCGACATCTGCCGCGTAGGCAAGCGGGGTCGTTGTAAAATTAGGACAGTTTTCGGTTTGTATCATTTACGTTTTCAT
CGTAGCTTGGGTTCTACCGTCGTGTGGACTGAAGTCTTGGTTGATCTGGCGTCACTAGGGTAGGAGACCAACGACTAGTTAGTGTCCATAATCAATAATA
CTATGTCCACTACAAAGCCACATACAAGTAGAGTAGACAAGTATTTTCGCACGGTGGCATCCTTGAAAGCCGCCCAGCGCGGTGAGCCAATTTGACACAC
TGCTACCTACGTTGTTCAGGCCGAACGACGATCAAAAATGAAACATTCGAAACGGCGCGGTGGCATGGTCGCGCTCAGCGTCCGCGCAATTCTGGTGCTT
GTGCGCGCCATCCACTTTCTTGACTTTGTCGCCCGAAGGCTCACCCCGGCCCGACCGAAAACGTCGACAGCCCAACGCCGATGGCTTCTTGCCCTATCCC
TACCGATACCCCGACCCCTATCGCGTCGCCGCACATCAGCACACTAGCGATGCATTATAGGACTCGGAATGCAACGCGCTACAATATTATCCTACAACGC
TATCTCGCATCTACAAACACGAGTGCTGGCTACGTTGTACAAGAGTTTTGTGTGTGTTTTGAGTGGTTAAAAAGCCTATTTTTTGCCCTTTTTACCGCCC
TTTTTCTTCTTTTTGCTGGTTTCCGCGAGCTTTTTCTTTTCGTCGAGAAGAATTTTGTGTGCGCGGTACGCGGCTTGGATCTTGCGCGAGGCAAAGGTCT
GCTTCTTGGCTTCTTCGCGCTTGAGAACTTCGAGTTCCTTGAGCCGTCGCTTTTCGTTTTCTTTGTTTTTTTGGAGCTCAACCTCCTCGACCCAGCGCTT
CTGGAGCCCCTCGAGCTTGGCGGCATTCGCATTGCGCTCGCTGGTGAGCTTGGCGAGCTCGGCCTGCTTGGCGGCCATGTCGCGCTCGTACTTTTCATTC
CAGTGGGTGAAGTCCTTGTGGAGGCTCTCGTGCTTGGCCTTTAGAAACCCGACCGTTTCGACATGCACCCGCGCCTCCGAGTCACACTCGCGCGTGACCG
CCTCAATCTTGGCCTTCTCTTCCGTGATGAGCTGCTGGTACAAGCGAGCAGTCGACGCCGTCTTGGCTTTGGCTTCGCTGCGCGCATACCGAATGTCGAT
CTGTGTCTTGGATTTGACCTACGCATGCGAGGTCATTGCATCGTTGTTCAATATGGATGACCACTTTGACATATCAGAAATGAAAAAATACATGAAAAAT
ACAAAAATAGGCCATTGGCAGCGTGCTAACATGTTGGTGGGTACCTGCAGAAGCTGCTCTTTCAAGAGTGCAATGGCGCTTTTTTGATCGGCGATTTCCC
GCGTGTGCTCGACTTTTTCCCGTGCGAGCTCCTGCGTGAGGCGCTTGACCTCTTCCGTGGCCTCCTTCTCCGTCTCGATGAGGTCCGCCGCCTTCTCGGC
CGCGTGTTTGCCTTCGGTGACGTACGTCACGAGCGACTCGTAGCCGCAGCCGCGGAGCTCCCGCGTCGTCTCGGTGAGTAAATCGATGAGTGCTTGGCGC
TCGTACTGAATCTTCATCAAATTGCCCCCGAAATTGGGATTGTCCTATGGACAATACTGTCCATCAACTGCTACATTCGCAACCACTACCTTGAGGTTGC
GACACAAACTCCGCGTGGACTCGCGCAGCGCGCGGCTGACTTCTTGAATGTCGCGCTGGGTTTCTTTAAACTTGGATTTGTTGGCGAGGCCCTAGCGACA
TCCATTCAAATTGTCTTCTTGTACATAGTAGAAGACAGTGTATACCTTGAGGACGCTTCGCTGGGAAATGAGGCTCTCGTACTTGGCTTCGAGGCGTCGC
TGCTCTTGGATGATGCGCGAGATCTCGTCGCCAACGACTTGCGAGAGCTCTTCGCGATGCTGCAGAATGTCGGGCGTGATGCTGCCAAGAAACGAGAGCT
TCTCGATCGTCTCTTCGAGGATCGCACACGCCCGCGTGGCCTCGACCGGCGACAGGCGGTGGGCCGCTTTCATCACCGCAACTGAAACCGGCGACCGCGT
CTGAAACTCCTCGTGCTACCGTATTGCTAGCAGCCGGCTAGTGTTTTTGGTCCGGAAGTGGACCCTGCATATACATCCCATTGCCAGTGCAAATGCACAT
TCATGCAGTTGTTGGATGACCTGCGACGTTGTCTCGTTCAAAGCAAACAAAACTGTAGATCGATCGATAGATAGATCGATCGATAGATAGATAGATAGAT
AGATAGATAGATAGATAGATAGATAGATAGATAGTGCATTCGGGTCAATCTTTACGGACTAGACGCAAAACACTGTTTTAGGTCGTATACTACTTGTTGG
CTTGGTCCCACCATTTCCTGTAGATCAGATCTACGACGTACCGGTAGTTGAAAATCCGACAGAGTTGTGGACCAAACGTACTCATCATGTCGTAGTACGA
CGTTGGAAACTTTAAACCTAACCGATACAGAACGATCATACGGCTTATCGCGGTTCCTCCGATACCACCGCAGCAGCAAGAGGTGCGTGAGGTTAATCTG
CGCGCCAAATGAAAGTGATGTCCCCGGATAAGTCATTCATTATCCGGATAATCCGCTGGCAGGGTAAACGATCTGAGGAATGGCAACGGTACGACACGAT
TTGCAAAATCTCTCTATTAGCTGAATCGTTGGCTGAATCCATGGGCTGAATCGTTGGTTTTTGTGGCCGGTCGCTTGGTCGAACTTCCACGTGGCAATCA
ATGTCTCGGCTCCGATAGCTGCACCGATGCTACCAGCTCCTTCTGCTTGCTCTGGGTCAGAAATGATTCTGGGGGCTATTCTAGCTATTCTGGGCGTTAA
AAGTCTTGCCAGGACTGCGATGCTGTTGTCAGTCGTGCATGCCGACAGATCTTTCCTTGCGCTGAATGAAGAGCAGTCGACTGACATGGTCAACCAACCA
ACGGTACGTGTGTCCTTATCTTAACGCACTGCCGAGGCGGCCCAGGGTGATCGCAGAAAAGAAGTCGTCGTTGAAGTTGGACACCTTATCCTCCTCGTTG
TTGCTTGTGGCGGATCGCAGGGATATCTCCTCGACCTCACACCATGTGTCGCATGAGATTCTGCCCAGATGCTATCATCACTTTATGGATTTGTCTTGAA
AAGACTATGCCATCGGGACGTTGGATGCTATGCCATCGCGCCGTTGGCCGCTGAATCTGCGGTGCCACGTGCTTGGGAGAGCTTTTACATGGCAGTCGGC
CCACATCTCGGATAGCTCATTTTCAAATCCAACACCAACCACAACAACCACCATGAACATTTACCCGCAGCAGACGTACGAGGTCGACGCCGGCCGGTCG
ATCGGCCACGCCAACCCGGGCATCGACCGCGCGTGCAAGGAGATCCAGGCGGCGTGCGCCGGCCTCGGCACGAATGAAAACAAACTCAGCACGGTCCTCG
GCAACAAGTCGCCCGTCGAGCGCTGCCTCATCCACCTCCGGTACCCGGAGCTCTTCCACAAGTCGCTCCTCTCCGAGATGGCGTCCGAGACGTCGGGCAA
CTACGGCAAGCTGCTCCAGCTTCTCTCGCAGCCGATCGAGGAGGCCGAGGCCATGATCATCCGGGATGCGACCAAGGGCGCCGGCACGAACGAGAAGCTC
TTGATTCCGGTCCTCAGCGGCCGCTCGAACGTCGAGCTCAACATCCTCAAGAAGGCGTTCTTCAAGAACTTCCAGACGGACCTCGTCGTCGCCGTCAACG
ATGACCTCAGCGGCGACCTCAAGACGTTCTACCTCGCAGTGCTCAACCAGATGGCGCAGCCGTACAACCCGAGCATCCACACGCCGGCCAAGGCGGCCGA
GATCGCCGAGGCCATCTACAAGGCCGGCGAGGGCAAGTGGGGCACGAACGAGTCGGCCTTTGCCAACGCGATTTGCTCGATCCCGCCCCAGTTCCTTGCG
GCCGTCGACGCGGCGTATGCGGCCAAGCACAAGCACGGCCTCGTGCACGCAATCCAGAGCGAGTTTGGCGGCAACGCCGAGGATGGCCTCGTGTACCACG
TCAACAGCATCTTGCATCCGATCGAGACCATCGTCGAGCAGATCGAGAGCACGATGAGCGGCATCGGCACGGACGAGTACCGTCTCTCGGCGGCCATCGT
GCGCTTCCAGCACCTGCTCCCGCAGGTCAAGCAGGCGTACCAGGCCAAGTACCGCACCACGCTCCGTCAGCGCATCGAAGGCGAAACGAGCGGCGACTAC
CGTGCGCTCCTCCTCACGATCCTCGACCATGCTATCTAGCTGGTTAAACCTGTGCATACCTGCATAATATATGGATTTTGGACGTGGACACGAACGTTTT
CCGACACACAGAGTAGGCAGTCAAGATTATGCGAGTACGCAGCGGAGAGATGACGAGCGCTCGACTGCCGTGGTGGTCACGCGAGGGAGCTGCCAAGGAC
GGTGCGTCAAGATGATTGTGGCGCCAAAGGTCGCGAAACGGGTCGAGTTGGGGTAGTTGGTAGCGAGGGCAGACGTGGTCGATTGTAGCCAACTGCGGAG
AGCCAACATCGTGCGATGCAGAGACTATTTGACTGGTGTTGACTTTCTGCATCGCAGGGATGGCAAGCATTTACCCGTTGCAGAAGTGACCCACTCGGGA
TGCTGAACATGGATTGTATTGAACTAGAGAACGGTATCTCGTTCGTACCACTACTACACGGATGTGTTGGAGGCTGCAGTTTTCTCTGGCTCCTCCAAGA
CCTTGGTATGGGCCTACTCGGATTTCTTGGGGTAGCATCGCGAGAGCAACGACGTTAGTTTGTAGCACATGTCGTTGGGCCGACACGTCTTGCCGTTGGT
CTTGAAGTTGCTTCCGTCGCACTGCGCATACGTCGCAAACTCGGTGCTTGTCGGCGGTGTGGGCAGGCACTGCGAGTAGGTCGAGGCGATGTAGACGCAC
GTGTTGCCAGAGGTACAGGTCGTCGCACCGGCGTACCCTCGACCACCGCACTGGCCGTAGACAGAGACGAGAGACTCACTTCGAAGTGCTCCGTGCGTCG
AGGCGCTCGCACACGAGAGAAGCGCCAACGCGCAGATTGAAATCGCACTTCGCATGGCTCGAGCAAAAGGCAAACTGAGCCGTCGCGACATTGCAGATTT
GCCGATCCTGGACATTGTATGGCATACAAATACCAGGTTACGAGCCGTTTCACACACCGCGTTTCGCCGACCGCCGGCGTCGATCCCTTGCTCGTGTGGC
CTTGGTCAAAATGGATACTTGCTGCAATCGCGCCATTATACAACCAACGCAAGACAATTGAGCGAAGAGACTCGCTCAAGCGTTTGTTGCAAAAAGCCTA
GTCTTCCCTCGCTACCACACCTCGAACCGTTTCGCGACCTTTGGCGCCACAATCCTCTTGAGGCATGGGCAGCACCCTCTCGTGACCACCACGGCAGTCG
AGCACGAGTCAACGCTCCGCTGCGTACTCGCAGCATTTCGCATTTTTGACTGCCTACTCTGTGTGTCGGAAAACGTCCGTGTCCACGTTCAAAATCCATA
TATTATGCAGGTATTCAGTAACAAGCTAGATGGCATGGTCGAGGATCGTGAGGAGGAGCGCACGGTAGTCGCCGCTCGTCTCGCCTTCGATGCGCTGACG
GAGCGTGGTGCGGTACTTGGCCTGGTACGCCTGCTTGACCTGCGGGAGGAGGTGCTGAAAGCGCACGATGGATGCCGAGAGACCGTACTCGTCCGTGCCA
ATGCCGCTCATCGTGCTCTCGATCTGCTCGACGACGGTCTCGATCGGACGCAAGATGCTGTTGACGTGGTACACGAGGCCGTCCTCGGCGTTGCCGCCAA
ACTCGCTCTGGATTGCATGCACGAGGCCGTGCTTGTGCTTGGCCGCATACGCCGCGTCGACGGCCGCAAGGAACTGGGGCGGGATCGAGCAAATTGCGTT
GGCAAAGGCCGACTCGTTCGTGCCCCACTTGCCTTCGCCGGCCTTGTAGATGGCCTCGGCGATCTCGGCCGCCTTGGCCGGCGTGTGGATGCTCGGGTTG
TACGGCTGCGCCATCTGGTTGAGCGCCGCGAGGTAGAACGTCTTGAGGTCGCCGCTGAGGTCATCGTTGATGGCGACGACGAGGTCCGTCTGGAAGTTCT
TGAAGAACGCCTTCTTGAGGATGTTGAGCTCGATGTTCGAGCGGCCGCTGAGGACCGGAATCAAGAGCTTCTCGTTCGTGCCGGCGCCCTTGGTCGCATC
CCGGATGATCATGGCCTCGGCCTCCTCGATCGGCTGCGAGAGGAGCTGCAGCAGCTTGCCATAGTTGCCCGACGTCTCGGACGCCATCTCGGAGAGGAGC
GACTTGTGGAAGAGCTCCGGGTACCGGAGGTGGATGAGGCAGCGCTCGACGGGCGACTTGTTGCCGAGGACCGTGCTGAGTTTGTTTTCGTTCGTGCCAA
GGCCGGCGCACGCCGCCTGGATCTCCTTGCACGCGCGGTCAATGCCCGGGTTGGCGTGGCCGATCGACCGGCCGGCGTCGACCTCGTACGTCTGCTGCGG
GTAAATGTTCATGGTGGTGGTGGTTGGGGTTGATGGTGGATTGGAAAGTGAGCTATCGGAGATGTGGGCCGACTGGTATGTAAAAGCTCTCCCAAGCACG
TGGCACCGCAGATTCAGCGGCCAACAGCGCGATGGCATGGCATCCAACGTCACCGTGGCATAGTCTTTTCAAGACAAATAATCCATGAAGTGGTGATAGC
ATCTGGGACAGAATCTCTGGCGACACATGGTGTGAGGTCGAGGAGATATCCCTGCGATCCGCCACAAGCAACAACCAAGAGGATAAGGTGTTCAGCTTCA
ACGACGATTTCTTTTCTGCGATCACCCTGCAAATGATCACCTTGGGCCGCCTCGGCAGTGCGTTAATTAGGACATACTTTTAGTTCGTTGGTTGACCATG
TCAGTCGACTGCTTTTCATCAAGCAAAAGGAAAGACCTGTCGGCATGCACGACTGACAACCGCATCGCAGTCCTGGCAAGACTTTTAACGCCCAGAATAA
CCCCCAGAATAAGTTCTGATGCAGAGCAAGCATAAGGAGCTGGTAGCATCGGTGCAGCTATCGGAGCCGAGACATTGATTGCCACGTGGAAGTTCGGCCA
AGCGACCGGCCACAAAAACCAACGATTCAGCCCATGGATTCAGCCCAACGATTCAGCTAATAGAGAGATTTTGCAAATCGTGTCGTACTGTTGCCATTCC
TCAGATCATTTACCCTGCCAGCGGATTATCCGGATAATGAATGACTTATCCGGGGACATCACTTTGATTTCGCGCGCAGATGAAGCCGATGCACCTCTTG
CTGCTGCGGTGGTATCGGAAGAACCGCGATAAGCCGTATGCTCGTTCTGTATCGGTCAAGTTTAAAGTTTCCAACGACGTACTACGACATGATGAGTACG
TTTGGTCGTTCTCGTCCACAACTCTGTCGGATTTTCAACTACGTCGTGGATCTGATCTACAGGAAATGGTGGGACCAAGCCAACAAGTAGTATACGACCT
AAAACAGTGTTTTGCGTCTAGTCGGTAAAGATTGACCCGAATGCACTATCTATCTATCTATCGATCGATCGATCGATCTATCTATCTAGAGTTTTGTTTG
CTTTGAACGAGACAACGTCGCAGGTCATCCAACAACTGCATGAATGTGCATTTGCATTTGCACTGGGAATGGGATGTATATGCAGCGTCCACTTTCGGAC
CAAAAACACTAGCCGACTGCTAGCAATACGGTAGCACGAGGAGTTTCAGACGCGGTCACCGGTTTCAGTTGCGGTGATGAAAGCGGCCCACCGCCTGTCG
CCGGTCGAGGCCACGCGGGCGTGTGCGATCCTTGAAGAGACGATCGAGAAGCTCTCGTTCCTTGGCAGCATCACGCCTGACATTCTGCAGCACCGCGAAG
AGCTCTCGCAAGTCGTTGGCGACGAGATCTCGCGCATTATCCAAGAGCAGCGACGCCTCGAAGCCAAGTACGAGAGCCTCATTTCCCAGCGAAGCGTCCT
CAAGGTATCTATCGTCTTCTACTATGTACAAGAAGACAATCTGAATGGATGTTGCTAGGGCCTCGCCAACAAATCCAAGTTTAAAGAAACCCAGCGCGAC
ATTCAAGAAGTCAGCCGCGCGCTGCGCGAGTCCACGCGGAGTTTGTGTCGCAACCTCAAGGTAGGGGTTGCTAATGTAGCAGTTGATGGACACTATTGTC
CATAGGACAATCCCAA