Description :
From Genome Similarity Track
Location :
scaffold_369:3180- 4287
Transcript NameFunction/comments
g7728.t1 conserved hypothetical protein

Sequence
1107 bases(100 bases per row)
TTCCACTCGCGCTGGTTCATCTCCGGCCGCTTCATCCGGTGATACTCGCTTTCGTGCGCTAAAGTACGGGAGACGATGCTGTGTGCGAGGTGACGGAAGG
CTTGAGCCTCGCCGTCAGGAAGCTCCAGTAACGGGGTCTCCGATGGCACTTCGACTGGGGACGTGGTGTATTTCGCTTGGTGAAGAAGCTCCTGTAGCTC
ATCGGGGGCTGTGGCTCGACGCGTGGCCTCTGGAGCGAAGAATTGGTGCTGTGCTGGCACGGACTCGGCCATAGTGGAGAGTTTCAAGGAGCTCGCGTTG
GCAAGAGGTGAAAATACCAACTGAGTTGGCCTCGGTTGGAGTGAGAGTGGACTGACAGGCTCCGTTTCTCTGCAAGTTATAGGCGACGACATCTGCTGTT
AATGTGGCGGGCGCTTCGCCACGGGCTCCGCACCACAAGGTCAGCAAGCAGGTGGCCGACGCAACTGGGCTGGCAGGTGGCGTGGAGGTCAGATTGAACA
GCTTGTGCGCCTCAGAACCGCCAAGTGTTGGGAATAGCTGACACCTTGACGCATTTCAAACGCAGCCGTTGACTTATTAATCAAAAGGTCAAGTGTACAT
GCACAGTAGATGCCCACGAAGTTCGTTCACTGTCACTTCGTTGCTCGCATGACGCAACCGAGAACGTCCCCAGTCTCCGTTTACGCCCCGGTTTCACCTT
GAGCATCCATGAGTCAGAACTGGACATGGATAGGGAGAAAAGCTGGCGTGCTGCTGCCTGAAGAGCGACGGTCGAAGCAGATGGAAGAGCTCTTTGCCTT
GATCTGTGCAGTAGTAAACCATTGCACCTGCAACACTTAATACCGAAAGGACGTATGCGATTTTGAAACACATTCGGGCATTGCTAATCTCTGTCGTCTT
CTCCTTCTGTTGCCTTGATGTCCACAGAGGACACCCTCTGGCCTCGTTCAAGCAGTTGCTACACGCTCCCTTGATACCAGACGAGGGAGTCTCTGCCTCT
GCCATCTTCACCACTTCCCCTGGTACAACCGATCTAGCCAAGTAGATACCATTGCAGCCTACGACCTCCCAATGCTGGAAGAAGACGGCAAAAGCGCCGC
ACCCCAC