Description :
From Genome Similarity Track
Location :
Scaffold_1238:318- 1925
Transcript NameFunction/comments
Phyta_totarag12487hypothetical protein PHYSODRAFT_256330

Sequence
1607 bases(100 bases per row)
AAGACTTAATGCTCATGGGCTGCTGTATAGTTGTAGTAGACGGTGTTTTCGTACTCTGATGCGCAGTACGGGaacttggtgtcgtcgtcgacgggtGTGA
AGAGTTCTTCGCCAGTGATGACAGTCACGTAGCACCCCAAGCAGAAGCACACGACGATCACAGCTAGAGCCGACACTTTTCCCACATGGGGAGCACACcc
cacttcttcttgagtAAGAACACTATCGGTAAGATGATGGAGTTCAACGTGATGCACGACGCGCCGGCGAAGTCCGACAGAGCCGAGAAATGGTCTTGAA
GATGACAGAGAGCACGACGAGGATCGAAATCATGAAGAGACGCAGAACCACGTACTTGACGGCATTGGCGCCGTGATACTCCGCAGCTTCCGTCTCTGCG
TTACCGAGGTGCACGTTTCCACTATCGGCGACAGAAATGAACGAGCGACGCTGAGTTTGGGACTGGGACGGTTTCTCGGTCATATTCGGCGTGGACACTT
CGGCGTAGCTCAGCAGGTTGTTTTCAACATCAACGGCAAGAGGTTTGTgcatgcccagcacgagACGTTCCGTGAGGTAGAACACGGGGTTGAGGATGAC
TGAGAAGGCGATCGTGATGTGCACCTGCATGGCGAGGTAGGCTAGAACGACGGCTCCCCAGTTCGGCGAATAGCCCAGTGTGGCCAACCCCGTCTCGGCG
TCCGGGTAGATCGTCCACAGTATGTTGCCCGAGATTTGGCACCCGACAGCAGAGTACGCAGTGCTGGCCAGGACTAGGAACAGGATGGAAATGGTGCCGA
TGGTTACGCCCACAACGCGGGGCATGCGACTGGGGTTGCTGTGCTGGCGGTGGATCGACGGGATCACAACACCGGAGCCGTACGCTAGTGCCAGACTGCC
GAGCGCGCGAATCAcctgcttgaagtggagcTCGGGGGCTGGCGCACTCGGGTGGCCACGCATGCCGTGCATCACAATTGCGCTGCCGGTAGCGTCAGCG
ACCAACGTGCCATGCACCCCGCAAAGGCGGCGCCGGCACCTTCCTTGAGAGTCGGCACTAGACACACAGGCATGACCGTGAGTGCCATGAGAACGGacca
cgtcgtcgtactGAAAGCGTCCGGGAAGAGGCCATCCAACAGAGTGCCGCcgagcaccaagaagacgcacGGAACGATAAGGCAGCTTGCCATTTGAACG
ACGACCGTGAGGTAGCGCCCGTGCTTTCCCAAAAACCATTCGCCCAAGTCGCCGTACGTCTTGACTGACGTCGGGGCAAGCAGCATCACGCGGCAGATAG
ACATAGCGCCGTAAACGTTGGCGAAGGCCATGAAGGCCATCCCGATGATCCCAAGCACGGGGCCGGCGCGAGAGAAGTTGCCAGGCATGCTAAGCGTGCC
AATGCCgtagacgcagcagaagaggTTGAAAGAcgccttggcgtcctccaTCGTGATGAAAGCTTTACGCGCCATGGTGTGCGCCAAGAGGTGACTGGGA
AGCttgtggtggaggaggaaaaTAGGAGACTGAGACGGAAAGCGGTTGGTTCGACTAGCGGCCGCGCAGTTGAAGATTCACCAGTGGTAAAGTAGTTTTA
ACAAACG