Description :
From Genome Similarity Track
Location :
contig_38:317991- 331885
Transcript NameFunction/comments
g8377.t1hypothetical protein
g8378.t1hypothetical protein
g8379.t1XP_009515470.1 hypothetical protein PHYSODRAFT_309106 [Phytophthora sojae
g8380.t1RAW41895.1 hypothetical protein PC110_g1935 [Phytophthora cactorum
g8381.t1KUF76156.1 60S ribosomal protein L17-1 [Phytophthora nicotianae
g8382.t1hypothetical protein

Sequence
13894 bases(100 bases per row)
GATGAAGCGCGAAATGCTAGCAGCCGCGGCATCCAGCAGTGTGCTGTTCGGGTAGATGGTAGTCACCGTCTGCACGCACTCGTAGATGATAGCGTAGCCC
ACATTGATCCCAGTGTCAGCACGACGCATGACATCGTGCAGCACCTCGTACATTCCTTCACTGGTCTGCTGGTCAGCCTGGCCCAACAGCGCCAGGATCT
TCAGCAAACGAATCTGGATCCAGGGGGCCGGGATGCGATGGTAGTCGAACTCACGAGGCAGACGGTGCTCCGTGATCTGCTTGAGAATACTCACAAAGCT
GGGCACGAGGTCCTTGTAGTCCGTGGGGATGGCCTCCGCCAGGTCGTGCAAGATGCAGAGCGTAGTTCCCATGACACTAGGGTCGCGGTCACACAATGTG
CGACGCAGCGCGTCTCCAACGTCGCTGACCGAGTCCGGGTTGAGCTGGTGGAAGCGATGGATGGCCATGACGGCCTTCTTGCGCACGAGCTCGGCGTCGT
GGCGCAGCAGGTCGAGGATCATGGGTTGCACGGCCGGCACCATCTCCACCGTCACGAGCTTGCAAACGGCCATGAGCGCCGCGCAGACCTCAAGGTGGTT
GGAGCTCTGCAGGTCTCTCTGCAGCTGGTTGATGATCATGAAGCGGAACTCGTGCGTGGGCGACAGACACAGGCTGCACGTAAGGTAGCCCACGCGCTTC
TGCATGAGGTTGGTGCTGGCAGTCATCTCCACCGCCTTGATGTAGCCGAAGGACGCGTCGTGGCCCAGCATCTCCACGTACATGAGGCGAATGAGGAACT
CGCGCTTGCGCTTGTTCACAAGGCTGCTGGACGTGCTGGACGACGCCGTCACCTCGTTCAGCTTGCGCTTGAGCTGCGCCACCTCATGGATGATGATGCG
GTCCTCCTCTTGCTTCGACTTGCTCTCGCCGATCGACTTGACCAGCTCGAAGAACTCCTTGGATAGGTGCCCGCCCGACATGGCGCGAAGCTGACGTGGA
CAGCGGCGAGATCGCGGATTGAGGGGGTGTCGGCACCGCGCCACGTAGTGTGGTTGTGTTGGCTATCCGACCAATACGATTATTTATATACGGGTTTTTA
AATAAAATGCAATAAATATTGGCTTTGCAAAAGTAAATCTTTGTAATGGTCGGATAGATGCGTAGTTTACGATCGCCCTATGGTGTGGCATATTCCGTCG
AGTGGCATATTGTGAGCTCATAAAGTGACGATGGACGGCGTGGAGCTCTCGGACGGAGTGCTGCGCTCCTACAGCGTCGCACGAAACTTCGTTCCGCAGG
TAGGACGTCGGTCTGCCAATAGCTGCTACTATTTGCTGGTGCGTACCGTTATACTGAGAGTGTTGTCAACTGCGCAGGAGGACGAAGATACGAATGGGCA
GATCACGTCCCTAGATTTCCATCGCAGTGGCGAGCGGTGCGTTACGAGTCGCAGCGACGGCGTCCTGTCCATGATCAACTGCTTGAGTGGAACGTGAGTT
GCATTACGCGGTGCTCTCGTATTGCTGTCGACTAGACCAGGTGAGCGTAGCTGACACCTTGCGATGCTCTCCACAGAGTCGCCAAAACGATTTTGACCAA
GCGATACGGCGTCGGCATCGTGCGGTTCACCCACCACCCGGACTGCGTGATCTTCTCTTCGGCTAACAATGCCAACGATCGTACGCTGCTGCGGTAGTGA
CTAACTGGAAGGTGTGTGTGTATCCTTGACAGCGTTGATGTTTGTGTTTGAGCAGACCGCATTCGGTACCACTCGTTCTTCGACAATAAGTTCCTCCGCT
ATTACACTGGTCATACCGACAGGTAGCTTGAACCTCTTAAGCGCCAAGCTGCTTATTTAGTTGGGAGTTAATGCTCATTCGGTCGTTGCATGCTCCCAGA
GTCACATCGCTGATGATGCACCCCACCGCAGACCAGTTCATTTCCGCTGGAATGGATGGCACGATTCGACTGTGGGATATCCGTAACTCAGACACCTCGG
TGCGTCGCAGTCTGTGAGTGCCCTTATTTGCGGCATTTATCTAACCGATATTGTTTTGCTGTGTAAAGGCTATCATTCGAACCGATCACTTGCCAGTCTC
GCATATCTGCGCTGCGTATGACCAGGAGGGTGTGGTGTTTGGTGTATACACGGACGATCACTTGATCCGGATGTACGATGCGAGGAATTACCAGGAAGGA
CCCTTCGCCAAGTTCTCGCTCTATGACGCGTCGGTCATGGCAGCCGTGGAGCCGTTCCTCGCGCAGATGCAGGCGCCGAGCTTGAATGTCAAGAAGCTGC
ACGCACTCGACATGAAATTCAGTCCCGATGGTAACCAGTTGCTCGTTACAACCAACCGCGGAGTGTTCATCCACCTCGATGCGTTTGAGGGCAAACTGCT
GCATCTCTTCAAGGAGCATGGCTTGACTCAGAGTCAGCGCAGCGAACCCCAGCTCGGTTGTTGCTACTCGGCCGATGGCGCGTATGTGGCCACGGGAGCG
GAAGACGGCAGGGTGTTCTTCTACAAGAGTTCTACCGGTCAATTCATGCACACACTCCCGCAGGGCCACAATGGGCCCGTGGTCGATTTGCAGTGGAACC
CAAAGCGCCACCTTCTAGCAAGTGGTGGAGGCAACTCGACAGTGTTGTGGTCGGCGGCTGGGGTATGAGGACTACCGTGCCGCAACAATAAACTTGCAAG
TTTTTAAATTTTGCTACAATTCATGTCCTTGCCAACACTCTGCCGCTACTGCTGAGAACTTAAGTTCTTCCCAGCCGTTGCATCACTTCGGTTGCTGGCG
CGCGACCTTCCGGTTTAGTGAAGTTCAGTCACGTGTTTAGTCACGTTGCTGGTTAAGAGTCGCACCAGAATTGTTACCGAATAGTGGTCTCACCAAACAA
TTCGTCCGGGTTAAACTTTTAATGCGCGACCATTGGGAGGGTTTTGGAACGCACCATTGGGTCTTTCCGAAGTCGAATTTCATGCAAGAAAGTGCCAAAG
CAACCACAAGTAGGGTTGTTGGAATGCTTCCAGTCGCCCAGGCACGCAATGGGCGAGTATGAAGTATGCACGATTTACAGCAATTCGTACTCGAGTACGA
TTTATAGTTGTGCAAGACAAGTCGTACGAATTAGAGGCGAAAGAGCCAAAAAAAAAAAACTGCAAGCACAATTCCGGTACATGTATTATTATTAATACAA
CACAAATTGGTTTTTAGGGCCTAATCTCAAATCGTCATCTTCAATCTCATCTGTTCGCACCGAACTCTTGCAATTTTGTGTGCCTGGCTCATCGACTCTA
CGTATGCACGAGTGCGCTCTTGCATTTCCATCCACTTTGCTTTCGTTTCGCGAGCTGACAGTCGTCAGACATCCATACGACTATGCTGTACGCTCGCCTA
TTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTCCGCAAGTCAACTCGGAGGACTACACGGTCAAGGCCGATCCCGCTACGACACTTATCAGTACCTG
GGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAAGACATCGCTGACCTACTCTTCACCATGAAGGATACCGTGACGCTC
GACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCGCTACAATATCGGTGGGTCTGGCAAAAACGTCATCGACGACAGCGGCACCGAGA
TCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAATCGTTTTGGCTCGATTGGTCGAGCAACGACACAGCCAGCAAAAGCTGGAATTG
GGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCGTGACGTTGACATCACGGAGGCGTTCTCAAACTCGCCACCATGGTGGATGAAC
AGCAACCATGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTGCAATCCTGGAATCATGGACAATTCGCGCTGTACCTGGCTACCGTAGTGAAAC
AGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCAACGAGCCTATGAGTACGTGGTGGCAGTATCCAGGTGGCCAGGAAGGCTGCCA
TTTTGAGGTGGACACCCAGAAGATGTCGTATTGAAACTGCGCTCTAAGCTGGACTACTTTGGGCTGCAGGACGTAGCCATTTCCTCATCCGATGAAAACT
CGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAGATGTGATGACTGCCATCGGAAAAATTAACACACACGGCTATGGTAACCGCGA
GTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAAGTTTTGGGACTCCGAGTACGGCGAGAAGGACGCGACGGGACTCAGCTTGGCT
GAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTCTACTGGCAGCCGTTTGACGGCGGGGGCTGGGGCCTCATCAATTCTGCTCCGG
GTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTCAGTACTCGCGCCACATTCGACCCGGCATGGCGATCCTTTCTTCGGATGACAC
GAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGCAACAGTGAACTCAGGCGACACGGTTTCGAAGGTCACTTTTGACTTGGCGAGC
TTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGCGGCACGGGTGCGCTTTACAAGTCCTCGAAGGTCGAGCTATCTGGCACGTCTT
TCAGTGTGTCGATCCCGTCTGCGTCGGTGATGACTTTCGAGATCGAGGGAGTTACTGTTTAGACTTCGTGTTGAAATCGGTGATTTTGAACACCTTGGAA
GAGTCTAACAAATAATGAAACGGATCAATTACATTAAGCTTTTTGTAATCATCTGATCTAATCGAGGTTGCCTGGTTGAGCTTTCGACACCAAGCAATGC
GTGATCTTTCACCGTGCCACAATCAACGCTTCAATCATGATGATCACTGCCCTGTTCTCAGGTTTTTACACATCTGAATGTTGATCAGCCGGCTTTCGAA
CCACTACAGAACAGATCGGAGAAAGCCCACGAAGTACGGGTACGGCACCTGGGGTACCTCGCTTGAGAGTCTCAAATCGCGTCTTTCACCTCTTCATCTG
TTCGCACCGAACTACCGCACGATGCCTGGCTCACGGCCCGCAAGTTATCTTTCAGGCTCCTGCATCACTCTGACAATAGCTCGTAGCACTCCTTTTCGGT
TCCCACTTTCGCTTTTGCTCTCCGCACTTAGAAGACGTCCCAGTATTTCGCCATGATGCTCGCAGCTTCAGTGTTGTCCTGTGTGCTGCTCGCTGTTCAG
TCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGACGCTTACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTGGGCCA
ACGTCTTCGGAGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAAGGAGACGGTGACGTTGAACGGCTCGACTACCGGCCTTCCGGCTTTGGGACT
CACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCGTTGACGACAGTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCGGCATTC
AAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACAAGCACGAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGGTTGGCC
TGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGCCGCCGTGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGATGGCGA
TAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTTGGCCACTGTCGTTAGTCATGCCAAGACTAGCTGGGGCATTAACATTACCTAT
GTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGTGGTCAAGAAGGGTGTCACTTCGAAGTGGACACACAAAAGGACGTCTTGGTTA
GACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTTCCTCATCCGATGAAAATTCGCCGACGCAGACACTGTCCACACTCACCTCCAT
GTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCATGGTTACGACGGCCAGAGCCCGTACCGAGGAGGGGACCGCGGCTCCTTGAAA
ACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGCGAGGACGACGCGACCGGGCTAAGTCTGGCTGAGTCGATCGCACTCGACATCA
ATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTGGAGCTTGGGGTCTTGTTCAATCCAACCCGGGCGATAGCTGGATTGGCACGCC
CAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACCCGGTATGGCTATCCTATCAACAGATGACACGAATACCGTCGTGGCTTTTGAC
GCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATCTGCGGTCACTTTCGACTTGTCCAGCTTCACAACTGTGGGAGGTCCGA
TCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCGAAGGTGGTTTTGTCAGGCACGTCATTCAGTGCGTCGATCCCTGCTGC
GTCGGTCATGACGTTCGAGGTACAGGGCGTCGCAGCGTAGTTTCCCTTTTCAAGCCACCGCAAATAAACATCATTTTCGACTGCCCACGATTTGCCCAGG
AAAAATAGGCATGAACCATGCAGCCAGGGTCTGGCGACCGCCAATACAAGTTGAAGTTGCTCTATCTTCATGCGGACTTGCAGCGCCTTGGTCTTCGTGC
TTCATATAAGGTTCGGCGTGAGTTCTCATGTAGGCAGCTTGCAAGTTGTTGTTCTCATTGTGTAGGCTTGCAGGTTGAAGGCCCCCGCACATAGGGCGTG
TTCAGCCAATCAGATCTTCCCTTGAAACCAACGAAGCCAACACAAAGTCAGTGACTGGGGAACCCGAGGAGCTACGAAAATGGTGGACACGTCGGAGGTC
CCGGCGCGTCCGGGTCAGATAACGACCGATTTCCTGCAGCAGATTCTGCGGCCTTCGTATCCTTCGCAGCGCGTGGTCGACTTCCAGTGGACCCCCATGA
ACATTGGCGTGATCGCGGAGGTGGCGATCATCACAGTGGAGTTTGAGCGCGACGACGGCAGTGGCGAGGCCAAGAGAACGCAGCACAAGTTCGTGGGCAA
GTTTCTGCGCCCGGAATTCCCGTTCGAGTCGATGTTCGCGGTGGAGTCCAAGTTCTACAACGAGTTCACGACGAAGGCAGGCGACACAGCCATGAGGAAC
TCGGCGGCAACTGTGGGGTTTCCGTTCGCTATCCCGACTGTAGTCTTCACATCCAACGTGCTGATCGTTCTGGAGTTTATCGATTCGACGAAGACCTTCA
CTTGCGTGGACGGAAGTCCACCCCAGCACATTCCGAAGCTGGTGACCAAACTCGCGCAGATGCACGCGCGCTTCTGGAACCACGACTGCGATGGTCTCGC
CGTTCCAGCGGGAATTGGCAGTCAGCTTACTGGTGAAGAGAAGCGCCTGCAATTCCCTGGCTGCTGGGCTGGTTACTTGGACGACGTGCCACTGGAAGCC
AGTGACAAGGCGCAATTGACAGCGTTATGCCAGCAACTGAGCGAGAAGCCTGATAAGCTTAAAGTGGTGCACGACAAGGTGGACGATGGCCCGTCTTCGT
TGATCCACGGTGACTTTCACATCGCAAACATGCTGCTATCGACGGATCCTGCAGATGAAGTAACATGGCTCCTGGATTGGGCAACCTGTGGTAAGGGCAA
TCCACTGCGAGATCTTGCCTTTTTCTTTATCGTCAGTGTCCAAGCAGCGCACCGCCGAGAACAAGAGGAACAGTGCTTGGAGATGTACCGCAATACATTA
ACAACAGAGCTGGAAGCTGCACAACTGCCGCTGGATGAACTGCATCGGCAGTATAAGATGTGCGTGTTGAACCAGTTCGTGATCCTGGTCGTGTACGACA
GCCTCAGCAAAAGTCTCGCGGCGAACGCCAAGACCGAAAAGATGCGTGTGGAGCTGGATGCACATTTTCGAGAGGTGAATCGCCGCGCGTGCTTGAGCGT
CCTGGACAACGTCGTCGAGAAGGACCTCCAGCTTCTGCAATGAAGGCCTTGCCTGAAAAATCAGCTGCTGTACGTGTAACTTCGATGGGTTTATACAATC
GGAATCGGCGACTTGCTTGCTCCCAGTCAATTAAGGGCGTGTCTTCTGGATCGGCTCGTTGCACAGCTGTTGTCGATACAGATTACGAGGCCGCTCGCAT
ACGAAAGTAGTGTCGGTCGGCTACCGACTCGGCAGGCATGGGCGGAGTCAAAGGGATCAGTTGTATTTTTACTCACAGCTATTGATACCGACCGGAACGG
CACAGTCATCGCTCATGAAACCCTATCATTTCATATGTGTTTCTTATTAATTTGCTGATATATACCTGTAATAATGAATATACCCTCATGTATAAGTTTA
TTTATTTGGATGATAAAACGAAGCGCTTACAGTACTCATTGTGCAGCCTGCTGTGCCCGCCCGTCTCGTCCTGTGTGGCATAAAACGAAGAACCGAGAGG
GGAGCAGGTGCACATCTCGGGCGCGAAGAAGAGCGGACATGGCGCGCTCGATCCCCAAGCCCAACCCGATCCTGGACACCCTGCTGGTGAGTCTGCTCGT
GTGCGAGCTGGTCGTCATCGTGCACACACTGTGGGATGACAAGCAGATGCTCTACATCCTCGTGGCCATGGTCTTCGTGGTGGCGCTGGCCGTCAAGGCC
ACAAAACCTCGTTCGCCATCGGGGGCGGATGGTTTTCGCGCACGTTCTTGCAGCACCTCGGGGACCCGCTCAAGAAGGCAGTGACTATGAAAAAGTGGTG
CGACCAGTCGTGGCAGCTCGCCATCCACGTGTCCATGACGATCTTCGAGCTTTATGTGCTGCGCGATGAAACCTGGTGGCAAGACACGACGACTTGTAAG
GAATGGGCAACCTGAAAACTGTGTGGTGGGAGGACAAGATATCTTACTGTGTCTATTATGTTTTCGTGTGGTGAATGACACTGCAGTGTGGAACCAGGGA
ACGGACACGGGCGTGTTCCCGACGCAGAAGTTTAGCACCAAGCTGCTTTACATCACGCAACTGGTGAGGGAGTGGCGTGCTTGTGTTACTGCGGACTTAT
TGGAAGCTGGTTAACGTTGTTTTGTACTTCGTAGGCGATCTGGATTTTCACTGCGTTCTCGTGCAAGTTCCTAGAGGAGATCCGCAAGGACTACTTAGTG
ATGATGACTCACCATGTCGTCACAATTGCGCTGGTCACGTGGTCGTACGCTGTTGGCTTTTTGCCTGTGGGTGTAGTCGTACTCCTTCTGCATGACATGA
CTGACATCCCTCTCGACATGCTCAAAATGGCCAACTACCTCAAGATGGAAGGCGTCCCGGGTCTGTTCACGAGCGAAATCCTGTTCGTCATCACGATCGT
GCTCTGGTTCTACTACCGCATCTACCAGTACCCGGTCAAGCTGCTCTACACGACGATTGTGGAGAACCGCGAGGCCAGCATGACAATGGCCAACGCACAT
GACTTCACGCAACTGTTCCCGTACCCAGGCCCTCCGTCGTGGCTGCTCTTCAACGTGCTGCTCACGACGCTGTACTGCCTACACATTTGGTGGGGCCTGC
TGCTTGTGCGGGTGCTCGTTGGCGTGGTAACCAAGGGTACCCACGACACGGCCAAGGAGGAGTACGAAGGCACATCTTCCGACTCGGACAACGAGAACAA
AGACGACTAGAAAGCAACTGCATTGTTGGCGTGAAAGGACTAGAATGTGAAAGAAGACAGCAATTTGACCAGAAGAGTAAGAAAATCGTCTTCTTCAACT
TGACCTTTACAACATCATAACGTATGCTATTATACAGGCCAATATTTGGCGCGAGCATTTTGACAACCAGTGGGATAAGAAGGTCGCCAGCAACATGATG
GAAGCGTTGGGCGATGCACCGCCGGTGTCGGTGCAGTCGCTGGTCACGGAGGTGTCGATCGTAAAGGCCCTGCGAGAGTTGCTTCCGACCATGGACGCAG
AAACGGCGACTCTGAAGTTGGTGATGCAGAAGCTGGCGGTTCGCTTCGGTATGGAGTTCCGGGATTTAAAAGCACAATGGAGACCTCACATCAAGGCGGT
GCTGCCGGAGATGCTGGACCAGTGTCTGAGAGGAGAAGCGTCCGAAGAAGAGGGCGAAAAGGACAAACACCGGGCGGAAGAGGAGGAGGAAGTTGATCTG
CGGCCCAACCGGAAGCGCACGACTAGAAAGCACAATGCAGTTGTTGATGCGAGTGATGAAGAGGCGGAGGAGGACACTGCTAGTGACAACGATGCAAGTG
GAGGTGAAGAAGCTAATCCCGAAGAAGACGATGAAGAGGAGGAAGACGATATTGCTCCAGCCAAAAAGAGACTGAAAGCGGTGCGAACGTTGCTTTTGTT
GGGTCTGACCTTTTCTCCTTCTTGTTACACCCTTCGAGGTATTATATGCTGATGCCTACTTTTTGCTGTTCTGGTTGTTTTTGCTTGCAGTCGAACAATG
GCCACTCGAGTTGGAGATCAAGTAAAAGCGATGGTCCGCCGGTGAAGAAAGCCAAGACTGTCAAACAACAAGATCCTCCGGGACTTGCCTCGTTGAAGGA
ACTGGGCCGTGCAGCTGGTGTAATGAAGTACGGGCTGGGTCCTATAGTATATCGAATTGTGTGGAAGTTCATGCTAACCAACTCGATTGTTTTGGGTTTC
AGTCCACGGCTGTACAGATTTCTGAACGGTGCCACATCGACTGAAGACTCAGAAGAGATCCTGCGCAAGCGATTACAAGATGCTGGCGTTGCCTTTAATG
GCACGTATCCATCAAGCCGCGATATCAGCGCCGCGAAGAGAAAGCACGACAAAGCAAAGGAGCTGGAGGGCATCGACACAAACCTGATTATTTCGGGCGG
GAGGTCCCGTCGTGGTGGCTCGCAGCACATTTCCTACAAGGAAGAGCGGATCAGTGGGGAGGAAGACAACGCAGAAGAGGAGGAAGATGAAGATGACAAA
GACGCCGAGGAGTTCGGTGGCAGCGACTCGGACTCGTCAGAGGCGTCATTTTGAGTTGGCTTTTGCGTAGTGGCGATGTGAGTGGATATGCAGTAGTAGG
TGGTCCTACCGCAAATAGAGAATTGCTTTCGTCTTGGGAGTGCAACGTTAGTGTTGTTTAGCCCTTTCGTTTTTGTGATACAAGCAGTTTTTGTGGGACG
ATATTTGTGCACATCGACTGTCGAATCTCGCTCCAGATCAATTTGTTAAGGGCACAAATCGGGGTTGTGTCCCATAAAGAAAGGTAATTCCAGATCTCAC
TTGCATTTCGTAAGGCGTCAAATTAAAATCATGTGATTGGATAAAATAGAAAAAGAACCACATGGGATTGGCCAAAAGTCGCCGGTAATTGCTTGTCCAG
GTGATTGGTGGTGGGAGCGCGTGGCCTGTTTGGTCCCGGGCGGCGCAGCATTTGCCGCTCCAGTTTCCAGAACCCGAACGTGAAGCAAGAATCATGCCGT
CCTACAGCCAGGAACCTGAAGACGCTCAGCGCGCCGCTAAGGCCCGTGGCTCGCACCTGCGCGTGCACTTTAAGCACTGCCGTGAGGTCAGCCACGCCAT
CAAGGGCATGCCCCTGAACAAGGCTAAGAGCTTCCTGCAGGCCGTGCTCGAGTACAAGCAGGCGGTGCCCTTCACCAAGTTCACGGGCGGTTGCGGCCGT
CACGCTCAGGGCAAGCTCCGCGGTGCCGCTGGCGACAAGTGCAAGTGGCCCCAGAAGGCCACCAAGATCATCCTGGACCTGGTGAAGAACGCCGAGGCCA
ACGCCGAGGTCAAGGGCCTGGACACGGACCTGCTGTACATCTCGCACGCGCAGGCCAACGCCGCCATCAAGCAGCGCCGACGCACGTACCGTGCGCACGG
TCGCATTGGACCCTACATGTCCAACCCGGCCCACATCGAGCTCATCCTGACGGAGAAGCGTGCTAACGTTGCCAAGGCCGTGGAGGAGGTCAAGCCCACC
AAGGTCTCCCGCAAGCGTCAGGCTCAGCTGCGCCTCAAGTCGGGCGGCGGCGTCCCGGCCAACTAAGTTGATTTCTTTGCTCGGGATATCTCTTGCCTGA
AACACGAACGGTCAGTCGGGAACGAGCGACTGGAGACGCGAGGGGGTGGCGAAAAGTTTGGTAAAACTTTTTAATACAGCCTTGCCGAGAAATGGGTTCT
ACTGATGCAGTGTCTGTTGCCAAGAGAGCAAGCGAGTTTCCAGTTCGTCTTCATGGCGTGTCCCTGCGTAGGTCGTTATGGTTTGCTTTGGGTGCGTACA
GTAACAGGTTTGATAGCGGCGGGACGGAAGTCGGGACTGAATTTGCTGCGCCGGCTTAGGAGATGACAGGGGAGAGTCGTGATACCACCACTATGAGGTC
GTCGGAAACTGGGGTAGCTAGGATGGTGGAGCGATATCCTGTGTGCTGACGAAGACGAGATCACTGATGACGGCGTGGCTACCTGTGACGTTGAAGACCG
AAGAAAGCAAGTCTAGCCATGCTTGTAGTCGATGCCGCGTCGGGAAGTGGACTACCCACACTTGCAGCGTGCTCGGGTCTTGGACAGTCATCCACCACTT
TCGGACACTGCGAGCGTCAGTCTCCTCCACAAATGTGACGAGGCTGATATTGTGAAGACGCATTACGTGCTTGAAGTTGCCGTAATGCAGGAGATGTTGT
GTCTGGTCGAGTTGCAGGTGTTGTATTCGCTTTTGCATCTTTGGCATGAAGAAGCCCACGGGCTCTTCGATGTGGAGCCACTCGCTGCCGGTGGTTGGGC
CCTCGTCTTCACTGACGGTGCTGTCCTCTTCGCAAGTGTCGTTGTCACGTTTCGACTTGTACCTTGATGGGCATGGAAACCGTCGCCATATCGCGCTGAA
GGCAAGCATGATTCCTCACTGCTGCTCCTTGTAGTCAAAAGAAAACATGCAACTACGCTGCATGCATCGTGCCAAATTCAGCTTGCAACTTCGATAGTCC
TCAAAAAGCTTGTTGCGTTGGTGCGTCATAAGAAGCTTTTGCCCATGCTAGGTCATTCACCGGAAATAGACCTCGACGTTGGTAGTGATGCCAGCCACGC
TGCAGTCGCACTGCCTTCATGACAATACAGTATCAACCGTGCAGTCTGCTAGCACACATTTAAGCTAAATTACTGCATGCAGCAAGAGTTCGTGTGGCGC
GTAGTGTCCATGGTGGTTAGTGCTGTAAAAGTGGACTAATTTTGATCTCAGACCATTTGGGACCATTTTGGGGCGTTTGACACTAATTTTGGCGGGAAAG
CGCGCATTGGTCAAGATGAAACCGAAGACGCAGAGCTCTCTGCTGAGTTTCTTCAGCCCTCCGTCGTCCGAGGGAGCGTCGGCCAAGAAGAAGGGCGCAC
CTGCAGCTGCGGGCACGGGCAGTAGCAGCAAGAAGAAGGCGCCTGCCAAAACGCAGACCAAGCGTGAGTCGCTGGGCAACACGCGCAAAAAGATCGAGTT
CTCGCCCAAATTGAAGCAGAAGCCGGCAAGCGACGATGTGGACATGGAAGACGCGGACAAGGCGAAGGCTGTGTGCGCCAAGCGCAAGGCGTAC