Description :
From Genome Similarity Track
Location :
Scaffold_269:31795- 33115
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_269-fgenesh-gene-0.11Pectin lyase

Sequence
1320 bases(100 bases per row)
GCCGACGCCAAAGTTAACGGTGCTGAGCGTGTGCTTCTTCGGCGCGGTGGCCTTGTACACGGCGACGCCCTTCATGCGCGCAGCGGCCGTGCTGTCCTTG
CTGCTGACGAGCGCGCCGGTGTTCGCGAGCGTGTTAGCCACGCACGCACGGCCCAGGTACTGGGTGCAGAGCGACTGGGTGTTAGAGGTCGGCACGAGCA
CGGAGCCCGTGGTCTTGGAGTCGTGCAGGTTTGGGTTGGTTGTGTCCTGGAAGTAGTTACCCTCCATGAGCACATAGGCGTCGCTCTGCACCTCGAACGA
GAAGCCCGAGTTCGAGTACCAGTAGTTGTTGGCGGCGTGCGCGACGACGTCGGTCTTCACGCCCGTGAGGCCGCCGAACTTTGGCGAGCGGCCCGAGGTG
TGGTGGATGTAGTTGTTGAGCAGGTTGATGCGCGTGGCCGAGCCTTCAATGATGAACACCCAGTAGTGGCGGCCGTCGCACGTCGCCGAGTACGGGGTCA
CGCCGTCGAACTCGGAGTTGCTGATCGTCAGGCTCTTGCAACTCGCGGCGTTCGTGGTCATCATCTGGCGGCCAACGAGCGAGATCTTGACGTGGTCGAT
CCACACGCGCTCCTGAGTGGCGCCCGTGCTCGTGCCCTGGAGGTAGAGCGCGTCACCGCCCCAGATCAGGTGCGGGTTCAGGTTGGTGATGTGGATGTTC
TGCACGATGACGTTGTTGCCCTGGATCCAGAGACCCTTGCCGATGATCACGCCCTTAAGGCCTTCACCGCGCAGCGTCTTGTTGTCGTTGATAATGAGGG
GATTCTTGGTACCCGCGACGTCGTACGTGATCGTGACCGCCTGGCCATCGATGCAGCCGCCAGTGTTGGCCATGCCGCCGCTCTGGAGGATCACATCCTG
GCCCTTGTACCCGTTGTTCTTGGCGAGACACTGGCGGTTCGAGAGCGGACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGGAGC
CACGGAAGTCGAACGACTTGTTCAGGATGATCACGCGCGGCTGGCTGTCTGAGAGGTAAGATTTGAGCTGCGCGATCGTGGTCGGGTACACTGGCGGCGT
GTTGCCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTGCCCGCGGCGAGGCCGGGGGCGTTGCCAGCGATGTTGGCCGAGATGG
TCTGCACCAGCACCGCGGCGATCGTCAAGAGTCCAGCGCGAAGAAGCTGCATGATAAGGTAGGTAGGCACTGGGCTTGCTCGAGGATGCTTGTTGCAGGT
GGAGGCGAATTGGAGAATGA