Description :
From Genome Similarity Track
Location :
contig_38:317949- 331843
Transcript NameFunction/comments
g8761.t1hypothetical protein
g8762.t1RAW25280.1 Endo-beta-1,6-galactanase [Phytophthora cactorum
g8763.t1ETI37636.1 hypothetical protein F443_16390 [Phytophthora parasitica P1569
g8764.t1XP_009515470.1 hypothetical protein PHYSODRAFT_309106 [Phytophthora sojae
g8765.t1RAW41895.1 hypothetical protein PC110_g1935 [Phytophthora cactorum
g8766.t1POM57901.1 hypothetical protein PHPALM_37528 [Phytophthora palmivora var. palmivora
g8767.t1hypothetical protein
g8768.t1hypothetical protein

Sequence
13894 bases(100 bases per row)
GTGACACCCAAGTACTTCAGGTTGTGGTTATCGCTCGAGATGAAGCGCGAAATGCTAGCAGCCGCGGCATCCAGCAGTGTGCTGTTCGGGTAGATGGTAG
TCACCGTCTGCACGCACTCGTAGATGATAGCGTAGCCCACATTGATCCCAGTGTCAGCACGACGCATGACATCGTGCAGCACCTCGTACATTCCTTCACT
GGTCTGCTGGTCAGCCTGGCCCAACAGCGCCAGGATCTTCAGCAAACGAATCTGGATCCAGGGGGCCGGGATGCGATGGTAGTCGAACTCACGAGGCAGA
CGGTGCTCCGTGATCTGCTTGAGAATACTCACAAAGCTGGGCACGAGGTCCTTGTAGTCCGTGGGGATGGCCTCCGCCAGGTCGTGCAAGATGCAGAGCG
TAGTTCCCATGACACTAGGGTCGCGGTCACACAATGTGCGACGCAGCGCGTCTCCAACGTCGCTGACCGAGTCCGGGTTGAGCTGGTGGAAGCGATGGAT
GGCCATGACGGCCTTCTTGCGCACGAGCTCGGCGTCGTGGCGCAGCAGGTCGAGGATCATGGGTTGCACGGCCGGCACCATCTCCACCGTCACGAGCTTG
CAAACGGCCATGAGCGCCGCGCAGACCTCAAGGTGGTTGGAGCTCTGCAGGTCTCTCTGCAGCTGGTTGATGATCATGAAGCGGAACTCGTGCGTGGGCG
ACAGACACAGGCTGCACGTAAGGTAGCCCACGCGCTTCTGCATGAGGTTGGTGCTGGCAGTCATCTCCACCGCCTTGATGTAGCCGAAGGACGCGTCGTG
GCCCAGCATCTCCACGTACATGAGGCGAATGAGGAACTCGCGCTTGCGCTTGTTCACAAGGCTGCTGGACGTGCTGGACGACGCCGTCACCTCGTTCAGC
TTGCGCTTGAGCTGCGCCACCTCATGGATGATGATGCGGTCCTCCTCTTGCTTCGACTTGCTCTCGCCGATCGACTTGACCAGCTCGAAGAACTCCTTGG
ATAGGTGCCCGCCCGACATGGCGCGAAGCTGACGTGGACAGCGGCGAGATCGCGGATTGAGGGGGTGTCGGCACCGCGCCACGTAGTGTGGTTGTGTTGG
CTATCCGACCAATACGATTATTTATATACGGGTTTTTAAATAAAATACAATAAATATTGGCTTTGCAAAAGTAAATCTTTGTAATGGTCGGATAGATGCG
TAGTTTACGATCGCCCTATGGTGTGGCATATTCCGTCGAGTGGCATATTGTGAGCTCATAAAGTGACGATGGACGGCGTGGAGCTCTCGGACGGAGTGCT
GCGCTCCTACAGCGTCGCACGAAACTTCGTTCCGCAGGTAGGACGTCGGTCTGCCAATAGCTGCTACTATTTGCTGGTGCGTACCGTTATACTGAGAGTG
TTGTCAACTGCGCAGGAGGACGAAGATACGAATGGGCAGATCACGTCCCTAGATTTCCATCGCAGTGGCGAGCGGTGCGTTACGAGTCGCAGCGACGGCG
TCCTGTCCATGATCAACTGCTTGAGTGGAACGTGAGTTGCATTACGCGGTGCTCTCGTATTGCTGTCGACTAGACCAGGTGAGCGTAGCTGACACCTTGC
TATGCTCTCCACAGAGTCGCCAAAACGATTTTGACCAAGCGATACGGCGTCGGCATCGTGCGGTTCACCCACCACCCGGACTGCGTGATCTTCTCTTCGG
CTAACAATGCCAACGATCGTACGCTGCTGCGGTAGTGGCTAACTGGAAGGTGTGTGTGTATCCTTGACAGCGTTGATGTTTGTGTTTGAGCAGACCGCAT
TCGGTACCACTCGTTCTTCGACAATAAGTTCCTCCGCTATTACACTGGTCATACCGACAGGTAGCTTGAACCTCTTAAGCGCCAAGCTGCTTATTTAGTT
GGGAGTTAATGCTCATTCGGTCGTTGCATGCTCCCAGAGTCACATCGCTGATGATGCACCCCACCGCAGACCAGTTCATTTCCGCTGGAATGGATGGCAC
GATTCGACTGTGGGATATCCGTAACTCAGACACCTCGGTGCGTCGCAGTCCGTGAGTGCCCTTATTTGCGGCATTTATCTAACCGATATTGTTTTGCTGT
GTAAAGGCTATCATTCGAACCGATCACTTGCCAGTCTCGCATATCTGCGCTGCGTATGACCAGGAGGGTGTGGTGTTTGGTGTATACACGGACGATCACT
TGATCCGCATGTACGATGCGAGGAATTACCAGGAAGGACCCTTCGCCAAGTTCTCGCTCTATGACGCGTCGGTCATGGCAGCCGTGGAGCCGTTCCTCGC
GCAGATGCAGGCGCCGAGCTTGAATGTCAAGAAGCTGCACGCACTCGACATGAAATTCAGTCCCGATGGTAACCAGTTGCTCGTTACAACCAACCGCGGA
GTGTTCATCCACCTCGATGCGTTTGAGGGCAAACTGCTGCATCTCTTCAAGGAGCATGGCTTGACTCAGAGTCAGCGCAGCGAACCCCAGCTCGGTTGTT
GCTACTCGGCCGATGGCGCGTATGTGGCCACGGGAGCGGAAGACGGCAGGGTGTTCTTCTACAAGAGTTCTACCGGTCAATTCATGCACACACTCCCGCA
GGGCCACAATGGGCCCGTGGTCGATTTGCAGTGGAACCCAAAGCGCCACCTTCTAGCAAGTGGTGGAGGCAACTCGACAGTGTTGTGGTCGGCGGCTGGG
GTATGAGGACTACCGTGCCGCAACAATAAACTTGCAAGTTTTTAAATTTTGCTACAATTCATGTCCTTGCCAACACTCTGCCGCTACTGCTGAGAACTTA
AGTTCTTCCCAGCCGTTGCATCACTTCGGTTGCTGGCGCGCGACCTTCCGGTTTAGTGAAGTTCAGTCACGTGTTTAGTCACGTTGCTGGTTAAGAGTCG
CACCAGAATTGTTACCGAATAGTGGTCTCACCAAACAATTCGTCCGGGTTAAACTTTTAATGCGCGACCATTGGGAGGGTTTTGGAACGCACCATTGGGT
CTTTCCGAAGTCGAATTTCATGCAAGAAAGTGCCAAAGCAACCACAAGTAGGGTTGTTGGAATGCTTCCAGTCGCCCAGGCACGCAATGGGCGAGTATGA
AGTATGCACGATTTACAGCAATTCGTACTCGAGTACGATTTATAGTTGTGCAAGACAAGTCGTACGAATTAGAGGCGAGAGAGCCAAAAAAAAAAAACTG
CAAGCACAATTCCGGTACATGTATTATTATTAATACAACACAAATTGGTTTTTAGGGCCTAATCTCAAATCGTCATCTTCAATCTCATCTGTTCGCACCG
AACTCTTGCAATTTTGTGTGCCTGGCTCATCGACTCTACGTATGCACGAGTGCGCTCTTGCATTTCTATCCACTTTGCTTTCGTTTCGCGAGCTGACAGT
CGTCAGACATCCATACGACTATGCTGTACACTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTCCGCAAGTCAACTCGGAGGACTACACG
GTCAAGGCCGATCCCGCTACGACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGAAGACATCG
CTGACCTACTCTTCACCATGAAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCGCTACAATATCGGTGG
GTCTGGCAAAAACGTCATCGACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAATCGTTTTGGCTCGAT
TGGTTGAGCAATGACACAGCCAGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCGTGACGTTGACATCA
CGGAGGCGTTCTCAAACTCGCCACCATGGTGGATGAACAGCAACCACGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTGCAATCCTGGAATCA
TGGACAATTCGCGCTGTACCTGGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCAACGAGCCTATGAGT
ACGTGGTGGCAGTATCCAGGTGGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGATGTCGTATTGAAACTGCGCTCTAAGCTGGACTACTTTGG
ACTGCAGGACGTAGCCATTTCCTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAGATGTGATGACTGCC
ATCGGAAAAATTAACACACACGGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAAGTTTTGGGACTCCG
AGTACGGCGAGAAGGACGCGACGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTCTACTGGCAGCCGTT
TGACGGCGGGGGCTGGGGCCTCATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTCAGTACTCGCGCCAC
ATTCGACCCGGCATGGCGATCCTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGCAACAGTGAACTCAG
GCGACACGGTTTCGAAGGTCACTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGCGGCACGGGTGCGCT
TTACAAGTCCTCGAAGGTCGAGCTATCTGGCACGTCTTTCAGTGTGTCGATCCCGTCTGCGTCGGTGATGACTTTCGAGATCGAGGGAGTTACTGTTTAG
ACTTCGTGTTGAAATCGGTGATTTTGAACACCTTGGAAGAGTCTAACAAATAATGAAACGGATCAATTACATTAAGCTTTTTGTAATCATCTGATCTAAT
CGAGGTTGCGTGGTTGAGCTTTCGACACCAAGCAATGCGTGATCTTTCACCGTGCCACAATCAACGCTTCAATCATGATGATCACTGCCCTGTTCTCAGG
TTTTTACACATCTGAATGTTGATCAGCCGGCTTTCGAACCACTACAGAACAGATCGGAGAAAGCCCACGAAGTACGGGTACGGCACCTGGGGTACCTCGC
TTGAGAGTCTCAAATCGCGTCTTTCACCTCTTCATCTGTTCGCACCGAACTACCGCACGATGCCTGGCTCACGGCCCGCAAGTTATCTTTCAGGCTCCTG
CATCACTCTGACAATAGCTCGTAGCACTCCTTTTCGGTTCCCACTTTCGCTTTTGCTCTCCGCACTTAGAAGACGTCCCAGTATTTCGCCATGATGCTCG
CAGCTTCAGTGTTGTCCTGTGTGCTGCTCGCTGTTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGACGCTTACAAGCTC
GTGGGATGGATGGGGAACGTCGCTCTGTTGGTGGGCCAACGTCTTCGGCGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAAGGAGACGGTGACG
TTGAACGGCTCGACTACCGGCCTTCCGGCTTTGGGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCATTGACGACAGTGGCACGG
AGGTCTCCATGCAGACTTCGGACCAAATGCCGGCATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACAAGCACGAGCTGGAG
CTGGGACGCAGATGTGAAGCAGCGTACAATGGTTGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGCCGCCGTGGTGGATG
ACGAACAACCATGCTACTGCAGGTGGAGACGATGGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTTGGCCACTGTCGTTA
GTCATGCCAAGACTAGCTGGGGCATTAACATTACCTATGTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGTGGTCAAGAAGGGTG
TCACTTCGAAGTGGACACACAAAAGGACGTCTTGGTTAGACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTTCCTCATCCGATGAA
AATTCGCCGACGCAGACACTGTCCACACTCACCTCCATGTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCATGGTTACGACGGCC
AGAGCCCGTACCGAGGAGGGGACCGCGGCTCCTTGAAAACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGCGAGGACGACGCGAC
CGGGCTAAGTCTGGCTGAGTCGATCGCACTCGACATCAATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTGGAGCTTGGGGTCTT
GTTCAATCCAACCCGGGCGATAGCTGGATTGGCACGCCCAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACCCGGTATGGCTATCC
TATCAACAGATGACACGAATACCGTCGTGGCTTTTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATCTGCGGTCAC
TTTCGACTTGTCCAGCTTCACAACTGTGGGAGGTCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCGAAGGTGGTT
TTGTCAGGCACGTCATTCAGTGCGTCGATCCCTGCTGCGTCGGTCATGACGTTCGAGGTACAGGGCGTCGCAGCGTAGTTTCCCTTTTCAAGCCACCGCA
AATAAACATCATTTTCGACTGCCCACGATTTGCCCAGGAAAAATAGGCATGAACCATGCAGCCAGGGTCTGGCGACCGCCAATACAAGTTGAAGTTGCTC
TATCTTCATGTGGACTTGCAGCGCCTTGGTCTTCGTGCTTCATATAAGGTTCGGCGTGAGTTCTCATGTAGGCAGCTTGCAAGTTGTTGTTCTCATTGTG
TAGGCTTGCAGGTTGAAGGCCCCCGCACATAGGGCGTGTTCAGCCAATCAGATCTTCCCTTGAAACCAACGAAGCCAACACAAAGTCAGTGACTGGGGAA
CCCGAGGAGCTACGAAAATGGTGGACACGTCGGAGGTCCCGGCGCGTCCGGGTCAGATAACGACCGATTTCCTGCAGCAGATTCTGCGGCCTTCGTATCC
TTCGCAGCGCGTGGTCGACTTCCAGTGGACCCCCATGAACATTGGCGTGATCGCGGAGGTGGCGATCATCACAGTGGAGTTTGAGCGCGACGACGGCAGT
GGCGAGGCCAAGAGAACGCAGCACAAGTTCGTGGGCAAGTTTCTGCGCCCGGAATTCCCGTTCGAGTCGATGTTCGCGGTGGAGTCCAAGTTCTACAACG
AGTTCACGACGAAGGCAGGCGACACAGCCATGAGGAACTCGGCGGCAACTGTGGGGTTTCCGTTCGCTATCCCGACTGTAGTCTTCACATCCAACGTGCT
GATCGTTCTGGAGTTTATCGATTCGACGAAGACCTTCACTTGCGTGGACGGAAGTCCACCCCAGCACATTCCGAAGCTGGTGACCAAACTCGCGCAGATG
CACGCGCGCTTCTGGAACCACGACTGCGATGGTCTCGCCGTTCCAGCGGGAATTGGCAGTCAGCTTACTGGTGAAGAGAAGCGCCTGCAATTCCCTGGCT
GCTGGGCTGGTTACTTGGACGACGTGCCACTGGAAGCCAGTGACAAGGCGCAATTGACAGCGTTATGCCAGCAACTGAGCGAGAAGCCTGATAAGCTTAA
AGTGGTGCACGACAAGGTGGACGATGGCCCGTCTTCGTTGATCCACGGTGACTTTCACATCGCAAACATGCTGCTATCGACGGATCCTGCAGATGAAGTA
ACATGGCTCCTGGATTGGGCAACCTGTGGTAAGGGCAATCCACTGCGAGATCTTGCCTTTTTCTTTATCGTCAGTGTCCAAGCAGCGCACCGCCGAGAAC
AAGAGGAACAGTGCTTGGAGATGTACCGCAATACATTAACAACAGAGCTGGAAGCTGCACAACTGCCGCTGGATGAACTGCATCGGCAGTATAAGATGTG
CGTGTTGAACCAGTTCGTGATCCTGGTCGTGTACGACAGCCTCAGCAAAAGTCTCGCGGCGAACGCCAAGACCGAAAAGATGCGTGTGGAGCTGGATGCA
CATTTTCGAGAGGTGAATCGCCGCGCGTGCTTGAGCGTCCTGGACAACGTCGTCGAGAAGGACCTCCAGCTTCTGCAATGAAGGCCTTGCCTGAAAAATC
AGCTGCTGTACGTGTAACTTCGATGGGTTTATACAATCGGAATCGGCGACTTGCTTGCTCCCAGTCAATTAAGGGCGTGTCTTCTGGATCGGCTCGTTGC
ACAGCTGTTGTCGATACAGATTACGAGGCCGCTCGCATACGAAAGTAGTGTCGGTCGGCTACCGACTCGGCAGGCATGGGCGGAGTCAAAGGGATCAGTT
GTATTTTTACTCACAGCTATTGATACCGACCGGAACGGCATAGTCATCTCTCATGAAACCCTATCATTTCATATCTATTTCTTATTAATTGGGTGATATA
TACCTGTAATAATGAATATACCCTCATGTATAAGTTTATTTATTTGGATGATAAAACGAAGCGCTTACAGTACTCATTGTGCAGCCTGCTGTGCCCGCCC
GTCTCGTCCTGTGTGGCATAAAACGAAGAACCGAGAGGGGAGCAGGTGCACATCTCGGGCGCGAAGAAGAGCGGACATGGCGCGCTCGATCCCCAAGCCC
AACCCGATCCTGGACACCCTGCTGGTGAGTCTGCTCGTGTGCGAGCTGGGCGTCATCGTGCACACACTGTGGGATGACAAGCAGATGCTCTACATCCTCG
TGGCCATGGTCTTCGTGGTGGCGCTGGCCGTCAAGGCCACAAAACCTCGTTCGCCATCGGGGGCGGATGGTTTTCGCGCACGTTCTTGCAGCACCTCGGG
GACCCGCTCAAGAAGGCAGTGACTATGAAAAAGTGGTGCGACCAGTCGTGGCAGCTCGCCATCCACGTGTCCATGACGATCTTCGAGCTTTATGTGCTGC
GCGATGAAACCTGGTGGCAAGACACGACGACTTGTAAGGAATGGGCAACCTGAAAACTGTGTGGTGGGAGGACAAGATATCTTACTGTGTCTATTATGTT
TTCGTGTGGTGAATGACACTACAGTGTGGAACCAGGGAACGGACACGGGCGTGTTCCCGACGCAGAAGTTTAGCACCAAGCTGCTTTACATCACGCAACT
GGTGAGGGAGTGGCGTGCTTGTGTTACTGCGGACTTATTGGAAGCTGGTTAACGTTGTTTTGTACTTCGTAGGCGATCTGGATTTTCACTGCGTTCTCGT
GCAAGTTCCTAGAGGAGATCCGCAAGGACTACTTAGTGATGATGACTCACCATGTCGTCACAATTGCGCTGGTCACGTGGTCGTACGCTGTTGGCTTTTT
GCCTGTGGGTGTAGTCGTACTCCTTCTGCATGACATGACTGACATCCCTCTCGACATGCTCAAAATGGCCAACTACCTCAAGATGGAAGGCGTCCCGGGT
CTGTTCACGAGCGAAATCCTGTTCGTCATCACGATCGTGCTCTGGTTCTACTACCGCATCTACCAGTACCCGGTCAAGCTGCTCTACACGACGATTGTGG
AGAACCGCGAGGCCAGCATGACAATGGCCAACGCACATGACTTCACGCAACTGTTCCCGTACCCAGGCCCTCCGTCGTGGCTGCTCTTCAACGTGCTGCT
CACGACGCTGTACTGCCTACACATTTGGTGGGGCCTGCTGCTTGTGCGGGTGCTCGTTGGCGTGGTAACCAAGGGTACCCACGACACGGCCAAGGAGGAG
TACGAAGGCACATCTTCCGACTCGGACAACGAGAACAAAGACGACTAGAAAGCAACTGCATTGTTGGCGTGAAAGGACTAGAATGTGAAAGAAGACAGCA
ATTTGACCAGAAGAGTAAGAAAATCGTCTTCTTCAACTTGACCTTTACAACATCATAACGTATGCTATTATACAGGCCAATATTTGGCGCGAGCATTTTG
ACAACCAGTGGGATAAGAAGGTCGCCAGCAACATGATGGAAGCGTTGGGCGATGCACCGCCGGTGTCGGTGCAGTCGCTGGTCACGGAGGTGTCGATCGT
AAAGGCCCTGCGAGAGTTGCTTCCGACCATGGACGCAGAAACGGCGACTCTGAAGTTGGTGATGCAGAAGCTGGCGGTTCGCTTCGGCATGGAGTTCCGG
GATTTAAAAGCACAATGGAGACCTCACATCAAGGCGGTGCTGCCGGAGATGCTGGACCAGTGTCTGAGAGGAGAAGCGTCCGAAGAAGAGGGCGAAAAGG
ACAAACACCGGGCGGAAGAGGAGGAGGAAGTTGATCTGCGGCCCAACCGGAAGCGCACGACTAGAAAGCACAATGCAGTTGTTGATGCGAGTGATGAAGA
GGCGGAGGAGGACACTGCTAGTGACAACGATGCAAGTGGAGGTGAAGAAGCTAATCCCGAAGAAGACGATGAAGAGGAGGAAGACGATATTGCTCCAGCC
AAAAAGAGACTGAAAGCGGTGCGAACGTTGCTTTTGTTGGGTCTGACCTTTTCTCCTTCTTGTTACACCCTTCGAGGTATTATATGCTGATGCCTACTTT
TTGCTGTTCTGGTTGTTTTTGCTTGCAGTCGAACAATGGCCACTCGAGTTGGAGATCAAGTAAAAGCGATGGTCCGCCGGTGAAGAAAGCCAAGACTGTC
AAACAACAAGATCCTCCGGGACTTGCCTCGTTGAAGGAACTGGGCCGTGCAGCTGGTGTAATGAAGTACGGGCTGGGTCCTATAGTATATCGAATTGTGT
GGAAGTTCATGCTAACCAACTCGATTGTTTTGGGTTTCAGTCCACGGCTGTACAGATTTCTGAACGGTGCCACATCGACTGAAGACTCAGAAGAGATCCT
GCGCAAGCGATTACAAGATGCTGGCGTTGCCTTTAATGGCACGTATCCATCAAGCCGCGATATCAGCGCCGCGAAGAGAAAGCACGACAAAGCAAAGGAG
CTGGAGGGCATCGACACAAACCTGATTATTTCGGGCGGGAGGTCCCGTCGTGGTGGCTCGCAGCACATTTCCTACAAGGAAGAGCGGATCAGTGGGGAGG
AAGACAACGCAGAAGAGGAGGAAGATGAAGATGACAAAGACGCCGAGGAGTTCGGTGGCAGCGACTCGGACTCGTCAGAGGCGTCATTTTGAGTTGGCTT
TTGCGTAGTGGCGATGTGAGTGCATATGCAGTAGTAGGTGGTCCTACCGCAAATAGAGAATTGCTTTCGTCTTGGGAGTGCAACGTTAGTGTTGTTTAGC
CCTTTCGTTTTTGTGATACAAGCAGTTTTTGTGGGACGATATTTGTGCACATCGACTGTCGAATCTCGCTCCAGATCAATTTGTTAAGGGCACAAATCGG
GTTTGTGTCCCATAAAGAAAGGTAATTCCAGATCTCACTTGCATTTCGTAAGGCGTCAAATTAAAATCATGTGATTGGATAAAATAGAAAATGAACCACA
TGGGATTGGCCAAAAGTCGCCGGTAATTGCTTGTCCAGGTGATTGGTGGTGGGAGCGCGTGGCCTGTTTGGTCCCGGGCGGCGCAGCATTTGCCGCTCCA
GTTTCCAGAACCCGAACGTGAAGCAAGAATCATGCCGTCCTACAGCCAGGAACCTGAAGACGCTCAGCGCGCCGCTAAGGCCCGTGGCTCGCACCTGCGC
GTGCACTTTAAGCACTGCCGTGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAACAAGGCTAAGAGCTTCCTGCAGGCCGTGCTCGAGTACAAGCAGG
CGGTGCCCTTCACCAAGTTCACGGGCGGTTGCGGCCGTCACGCTCAGGGCAAGCTCCGCGGTGCCGCTGGCGACAAGTGCAAGTGGCCCCAGAAGGCCAC
CAAGATCATCCTGGACCTGGTGAAGAACGCCGAGGCCAACGCCGAGGTCAAGGGCCTGGACACGGACCTGCTGTACATCTCGCACGCGCAGGCCAACGCC
GCCATCAAGCAGCGCCGACGCACGTACCGTGCGCACGGTCGCATTGGACCCTACATGTCCAACCCGGCCCACATCGAGCTCATCCTGACGGAGAAGCGTG
CTAACGTTGCCAAGGCCGTGGAGGAGGTCAAGCCCACCAAGGTCTCCCGCAAGCGTCAGGCTCAGCTGCGCCTCAAGTCGGGCGGCGGCGTCCCGGCCAA
CTAAGTTGATTTCTTTGCTCGGGATATCTCTTGCCTGAAACACGAACGGTCAGTCGGGAACGAGCGACTGGAGACGCGAGGGGGTGGCGAAAAGTTTGGT
AAAACTTTTTAATACAGCCTTGCCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGCCAAGAGAGCAAGCGAGTTTCCAGTTCGTCTTCATGGCGTGTC
CCTGCGTAGGTCGTTATGGTTTGCTTTGGGTGCGTACAGTAACAGGTTTGATAGCGGCGGGACGGAAGTCGGGACTGAATTTGCTGCGCCGGCTTAGGAG
ATGACAGGGGAGAGTCGTGATACCACCACTATGAGGTCGTCGGAAACTGGGGTAGCTAGGATGGTGGAGCGATATCCTGTGTGCTGACGAAGACGAGATC
ACTGATGACGGCGTGGCTACCTGTGACGTTGAAGACCGAAGAAAGCAAGTCTAGCCATGCTTGTAGTCGATGCCGCGTCGGGAAGTGGACTACCCACACT
TGCAGCGTGCTCGGGTCTTGGACAGTCATCCACCACTTTCGGACACTGCGAGCGTCAGTCTCCTCCACAAATGTGACGAGGCTGATATTGTGAAGACGCA
TTACGTGCTTGAAGTTGCCGTAATGCAGGAGATGTTGTGTCTGGTCGAGTTGCAGGTGTTGTATTCGCTTTTGCATCTTTGGCATGAAGAAGCCCACGGG
CTCTTCGATGTGGAGCCACTCGCTGCCGGTGGTTGGGCCCTCGTCTTCACTGACGGTGCTGTCCTCTTCGCAAGTGTCGGTGTCACGTTTCGACTTGTAT
CTTGATGGGCATGGAAACCGTCGCCATATTGCGCTGAAGGCAAGCATGATTCCTCACTGCTGCTCCTTGTAGTCAAAAGAAAACATGCAACTACGCTGCA
TGCATCGTGCCAAATTCAGCTTGCAACTTCGATAGTCCTCAAAAAGCTTGTTGCGTTGGTGCGTCATAAGAAGCTTTTGCCCATGCTAGGTCATTCACCG
GAAATAGACCTCGACGTTGGTAGTGATGCCAGCCACGCTGCAGTCGCACTGCCTTCATGACAATACAGTATCAACCGTGCAGTCTGCTAGCACACATTTA
AGCTAAATTACTGCATGCAGCAAGAGTTCGTGTGGCGCGTAGTGTCCATGGTGGTTAGTGCTGTAAAAGTGGACTAATTTTGATCTCAGACCATTTGGGA
CCATTTTGGGGCGTTTGACACTAATTTTGGCGGGAAAGCGCGCATTGGTCAAGATGAAACCGAAGACGCAGAGCTCTCTGCTGAGTTTCTTTAGCCCTCC
GTCGTCCGAGGGAGCGTCGGCCAAGAAGAAGGGCGCACCTGCAGCTGCGGGTACGGGCAGTAGCAGCAAGAAGAAGGCGCCTGCCAAAACGCAGACCAAG
CGTGAGTCGCTGGGCAACACGCGCAAAAAGATCGAGTTCTCGCCCAAATTGAAGCAGAAGCCGGCAAGCGACGATGTGGACATGGAAGACGCGG