Description :
From Genome Similarity Track
Location :
Scaffold_177:31793- 34620
Transcript NameFunction/comments
Phypl_g4762hypothetical protein PHYSODRAFT_314779

Sequence
2827 bases(100 bases per row)
CAATGCCGTCAAGACATCTATCTACACCCCGTACAACTCTCTTCCGAAGAATTTGTTCAAGCAGTTCACGCGCTTCTCCAATGTTTACTTCCTCGTGATC
ACGGTTTTGCAGCTATTACCGCAAGTGACGTCCTCAACCGGGGTGCCGACCATGGTCGTCCCGCTCATGTTTATTATCGTGGTGAGCGGGGTACGAGATA
TCCTGGAAGACGTGCAGCGACATCGAGCGGATGCTGAGCAGAATAGAGCCCAAGTACGAAAGTTTACGTTCACAGATGGAAAAGCTGGCGCTTTTCACGC
GGCAACGTGTGAACAACTGAAAGTGGGAGAATTGGTCCGAGTCGCGGAGGATGAGGAGCTACCTGCTGATATCGTTCTGGTTGCTTCGGGCTCCCCGAAT
GGACAATGCTACGTGATGACAGCAAACCTAGACGGTGAGTCTTCACTAAAGCCCAGGTTCGTACAACCAGATCTGTGTCGACCACCCTATCGAGACTGCT
TCTCGAGCGATGGCCAACACGTGATGTCCCAGGCCACGACGCTTCTGCCTGGCGTTCATATCGAGTGTGAACACCCCAACCGATACATCGATAAGTTTAA
AGGAACGCTTGTGCTTACAGAGTCACGTTCGACAAGCCTGGACATCTCGCACGTATTATTGCGCGGCACGCATCTAAAAGACACGCCCTGGGTCATTGGA
GTGGTGATCTACACTGGAGATGACACTCGCGTGCGCCAGAACGCTTCCGAAACACCAACCAAAGCCAGTTGGTTAAGCCACTTTATCAACCAAATCACGG
TTTGGATCGTGGTTGTGCAGGTTGTCATTTTGATTGTCGCCGTTGCTGTTGAAGCGCAGCTTGTGGGATCTCCACACGTGCAGCAAAATCCGTATATCCC
CGACGACATCAAAGACAGCACCTTCATGGACTTCGTTTGGCTCTTCCTGGCGTACATGCTGCTTTTCTCGAACTTCGTGCCTATTTCCTTGCAAGTGACC
ATCGACTTCACCCGGTACTTCCAAGCAAGAGCGATCACGAACGATCCTGGCATGAGACTGCCTCCGATTCGACCCTCATTGATCGCCACACGTGATGCGG
CCGACAAAAAGCACGTTGTGTGTGTCCAGTCGAGTGAGTTGAACGAGGAGCTTGGTCTTGTTGAACACATTTTCACTGACAAGACGGGCACACTCACCTG
CAATCGAATGTCTTTCCGGTCCTGCCATGTCGACGGTGAAACgttcgacttcgacgagaaaGACGGCTCGCTGTTGACCTTGGAGCAGACTGTGGACGAT
ACCATCTTGGGCGCAGCGGATGAAGACGCTCAAAGACCCTCCCGTCGAAGAAACACGATCACATTGTCTAGCTTCCCATTCAAGAGCACGCCCATGCAGA
GGTTCCTACTGAACCTCGCTGTGAACAACTCAATCTGGCCCAGTGCTCCGTCCGCTGCGCAGGCTCCAACTAAACCCACGAAACCTGTTGGGATGGAATA
TGCAGGTCCGTCTCCAGACGAGCGCGCTTTGGTTATTGCTGCGGCACAAGCTGGCGTCGAGCTTCGAGGTCGCAACAATACACGCGTAATGGTACGCGTT
CATGGCACAGATACGGAGATGGAGATACTCCATTCGTTCGAATTCACTAGCGACcgcaagaagagctcgaTCCTATGCCGAGAATCCTCCGGAAGAATAG
TATTGATGAGCAAAGGAGCCGACTCCGTGATCCTCGAGGCTTTGAGCGAGTCTGCGAACAAACCCAGCGCAGTTTCACAAGCGAAGGAGCAAATGAAAAC
GTACTCCGCTAACGGTCTGCGCGTTCTGTGCATCGCGGAGCGGGAGGTGAGTGCTGATGAATTCCGCTCGTGGAACTCGCGCTACTTGACACTCAAGAAC
AGAACAAcgcgaggagcagcagaggaagagTTAGCCCAAGTGACCTCggagcttgagcgccggCTTGTGCTCGTCGGCGTGTCAGCGATCGAAGACAAAA
TCCAAGATGGTGTTCCAGAAGCTCTAGAGAAATTCCGTGCAGCCGGAATCAAGGTTTGGATGCTTACCGGCGATCGGGCGGACACGGCAACAAACGTAGC
GCACGCTGTGCGGTTGGTTTCTGCCGAGAtgcggctgctgcgactgTGTGAAAGCACGTGGGCGGAGGGTTCGAAACACGAGGCGATTGATTTTCTTCAA
CGAGAGCTCCgcaaagctcgagaagaaggcgaagtgGGTGGAGCTGAACGTATCACAAGCTCTGTGCTCGCGAAAAGCGGCGTGGCTAGACCCGGCTTAG
CTCTCTTGATTGACGACAAAGTCGTTGAAGCTGTCACGGGCTTTGGCCTCGAAAAGGAATTTCTCGAGCTTTGCATGCAATGCGAATCTGTGCTTTGCGC
TCGTATCAGCCCAAAGCAGAAGGAGTTGATCGTTGGAATGGTGCGCAGCTTTTGTCCGAACAAGGTGACATTGTCCATTGGAGACGGTGCCAACGATGTT
CCGATGATTCAAGGAGCGCACATTGGCGTTGGTATAGCGGGTGAAGAGGGTCACCAAGCTTCGGATGCTAGTGATTACTCGCTACCAGCTTTCCGGTTTC
TCCAACGACTTGTGCTAGTTCATGGCCGTGCCATGAACCGGCGCATTGCAGTTCTGACCTTGTACGTGTTCTacaagaacgtgctgcttgtgctACCGCA
GTTCTTCTTTGGCGCTTACTGTCTCTACTCAGGGCAGAGCACGTATTTCGATACTCTACTGCAGCTGTTCAACATTGGCTTTACGGCACTTCCTGTACTC
GTGTTCTCGGTGAAAGACGACGATATC