Description :
From Genome Similarity Track
Location :
Scaffold_911:3179- 7727
Transcript NameFunction/comments
g14605.t1hypothetical protein
g14606.t1hypothetical protein

Sequence
4548 bases(100 bases per row)
CATTACTTCTCCATCAGCACCAACAGCCGTCGCGGGGACGTTTACCTGGACACTCTCGTCGTTACCTGAAAACAGCGGCAATCACGATTCGGTGCTCGCT
GGAAGTTTTTTCTTCGGACGATCTTGCGTGGACTGGTCGAGGGTCGGTGTGATTTGGACATTCTGCTTGATCCTTTCTTCATGCACCGACCTCGGCCGGG
TGAGGAGAAGATGTGGTATCCAGGGCAACATGGCAACTCGCAGGCGACGAATCTGATCACTGCAGTCCAAGAGGCGGACTTGGCTGAGCCCTGGCGGGTC
CAATACCGTCACGACATCCGATCGCATCCCGCGCAACGTATTGCGCGTCTTCGTGGCAAATTCGTCATCCCAGCTTCCCCTTAAGCGTACACTTGAGTGT
TAGTCTGCATGTAATTCCATTTTTTCCACCTCTTTTTCTCCAGTCGTTTCCCTTGATCGGGCCGATCGAACCTCGTAATCGGTTCTCTCCCCCTTCATGC
CACTTGTGTTTTTGTACAATACCTCCTCCTTTTTTCTCAGTGCAGCCACCCTGCACCCATTTCACTCCCAACTTGCAGCGATCGCTTCGAGTTGTCCTCC
TCTGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGTCTAGTACGCTCGCGCTCAAACTCGTGCAGCAAAGCCCCGCAGTTGAGGTCAGCCTCGTCGA
CCCAAGACGGTTCGGTGTACCCCTTCCAGAAGACCTGGAATTCCCGATGGACGCGTCCATATCTGGTCTTACGACCTGATCGGACATCTGCGATCCGATC
CACTTCAAACTCGTCATCGCTCCAGTCGCCTTCCCAGCTGTCCTCTGGCAACAACGCCTCATCAAAATCAAATCGACCACTCTCGTCTGTCGCTAGCGTC
ACATCGGGACGATCAGGGAACACCTTTACGGCCTTGAGCTCCGAGACGTGCACAATCGGGAAAAGGCGATACTCTGTACCGGCCACCTCTAGCCGGGCTG
CATAGGGGCCAATCATCTCACGCACCCGGAACGGTCCGTGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGGTCCAAATATAGCCACAC
TTGCGATCCGACCTCAATCTGGTGCGGCCTTATCCCGTCGTTGTGGCGATCGGCTCTCGCTTGGATCGCCTCCTTCAGACGCGCGTTGACCTCCTCGCGA
GCTCGCTGGTACTGTTGCTGGATACGATATCTCCATCTGCGCGGCTCGCGATCGCGACGTCGCGTACTGCCTAACGGTAGCGACGCTTCCAATGTCGATC
GCGGGTCCCAGCCGTGGACGAGGTAGAACGGCGTCTCTCCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGCTCCGCGTATTCGTCCCA
GTCTTGCTGATTCACATCGGCGACGTACATCTTCAAGGCGCAGGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCTTGTGGTCGATAGGCCATG
GTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGGAAGAAATCAGACATAAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGCTCCGA
AGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCGACCCA
CACGAGAAGCTCCGTGTTGCCCTTGAACGATTTTGGCAGAGATGGGATATGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCCCAGGT
GATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGCAATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTGGAAGT
GCGCTTTGATCCGTTGGTACGTCCTCCCGATTCCCTGGTGCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCAGGTAC
CACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATCAGGCGGTGTTCACACAGTAGAACAGCAGGCCGTCTTCCCCCACTTCGTAATCTCCAGCGATC
TTGGCGCACGCTTTTGCATCTCGGGCAGTCAAGGCTGCTACGTCGCCCCGCAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGCTTGTA
CTAACCTCTCACTCCTCATGCGTTTGGACGATCTCTTCTTGCATAGCGGCCGGCACTTGACGGTGCCTTCGGGCTGATCGGGTCACTGCTGATATTTGAA
CGACGGGGTCGTCATTACTCGGGTGGAGCAACTCGCCCAGGCGGTTGATCGTGGCGAGACCGCCAATTTCGCCCTCATCAGTTACGATCACGCCTGCTTC
TCGTTGCAGCGCCGCACTTGCCAACCGATCGGCGCTCTGATTCCAATCGCGCTGTACATGGAGGAATTCGTGCTTCGGCCAGGTTTTCACTTGATCCATC
GCTTTCTGACGTAGTATCTGGAGACCCGGTGCCTTGCAATCAATTTCACCATGTATCTGGCGGATGATCAGGTTGGAATCTCCACAAATCACGACTCGCC
CCCTGTTCTGATTGGACAGTAACTTGAAGCCTAGCAGAAGTCCGCGATATTCGGCTTCGTTGACAGTCAGATCGTCGGCGAATTCGGATGCGGCAGATAT
GATCGACCACTCCGGGAGCTTCCAGACAATTGCACTATACGCTCCGGCGCTCCGCTTGACGCGTGCTGACCCATCAAAACTGACGACGAGCAACTCTTCA
TCCAGTTCTACCGTCGGCGGAGCCATCACGATCGTTCGTTTGGGCTCTTTCACCGGTGCAATCGTGATCAAGGCCTCGTCCACTTCCGCTCGGGGTGTAA
TGCTGGCGGCGATCGCGCCCAGGATTTCGTTCTCTCCTTTCAAGCACTTCCGGATTTCTAAGGTCCACTCGGACAGCAGAGCTGCCCATCGTCCCAATCG
TCCCTGGAAGCCAGACGAATTCAACAACCAGGCGAGCGTCGAATACCTCGATAGCACCTTGATCGATCGGTTGGTCAGGAGTGTGTAACACACGTCCAAG
ATCCGGAGGAGCGCCAAAACTTCCTTGTCCACTATGCCGTAATTCAATTCGTTCGACTTCAGCGTACGACTGGTGAAAATCACAGGCCAATACATGCCAT
CATGTTCCTGAACCAACGCAGCTGAAATAGCCCACTTGTTGGCATAAACCACGATCACCGGCTGGCGGTCGGGATCGAAGTGTCGTAAAATCGGGGTGGT
CGCAAGTTTAACCTTCAGTAGATCGAACGCCGTCCTCGCTCTAGCCAACCGATCGTCGGACTCCGTTGCTCGGCCCTCATGCTTCCCGTGGTGCATCTCG
TAGAAGTCCACTTCTCGCAGTTCGTATAAGATCGCGGCGTATACGGCGAAGTCTTCAATGAAGCGACTATAGTAATTCAGGCTTCCTAAGAAGGACTGCA
TCGATCGCAACGTCTTCGGAAACGGCAACTTCTCCAACGATTCCAGATCCTTCGGATTGGCTTCCAAGCCTTCGGCCGATACCCGATGACCCAAGTAATC
CACCTTCCGATGTCCCCAGAAACTCTTGACCACGCTGATCGACAGATTCCATCGTTCGCAAGCGTCAAGCAATGCCTCGACCTTCTGGCAGATCGAGTCC
CAGGTGTCAGCGGTGATCAAAATATCGTCGATGTACGATCGCCTGCCCAGCACCGAAGGTCCCGGGTTCGCCTCGGGTTCTCCTTTCTCGAACACGTCGG
TTGGTTCCGTGTGGTCTCGATCAGGACTTATTCGGAGGTATCCGTACAGAGCATTATCGATCAGCCTCTGGTAGATTTGTGGGGCGTTCTTCAGCCCGAA
GGGCATACGCGTCCACTCGAAGAGTCCGAAAGGCGTAACGAAAGCGGAGATCTCCCGCGCACGTTCCGTCATTGAGACCACCCAAAACCCACTAGACATA
TCCAAAGAGCAGTACCAGAGTACTTTGTCCAAGTCTTCCAGGAGATCGTTGATCAGCGGTATGGGATATACCATCAACCTGGTCAGGCTATTCACCAAGC
GGTAGTCGATACACAACCGGATGTCGACTCCGTTCTTCTTGATGATGATCACGATCGGAGATGCCCATGGTGAGGTGGATGGCTCAATCATCTTTGCGGA
CAACAAACTCTTGATCAGATCAGACAGTTTCTCTCGGAATTGAGGGGCAACCCGCCGCACGCGTTGGGCGATGGGAGCGGCTCCTCCAACGTCGATGTCG
CACACCGCACCAATCCCAGCGGGCGGGAGGGCGTTCCCTTTACCGATCAGCAAGTGTCGTCGTCGCCAGATGATCGGGCGAAGTCGATCGATCTCCTCAG
GTGTATTCGTTTCCGGATCACCCACTTGAATGTCTTCGATCGTGACTTCGTCGGTGGTGGTTGGTACTTCGGGTAGGATAGCCATTTGGCTCTCAACGTC
TTCCGCAAACAAGGCACCACCTTCATGGAAACACACCTCTTCGTCTTC