Description :
From Genome Similarity Track
Location :
scaffold_60:31784- 33797
Sequence
2013 bases(100 bases per row)
GCTCTTTCCGCAGCGACAGAAGGCTGGTCGTGTTCTTTAAGGCAAGTCTCTGCATTGTAGTCCCAACTTCTGCGTGAAGTAAGCCACAGGTGGCAGGCGG
attgttcacgctttcaACAAATTAAGCGATGCGACCATTCGCCAATTCCACGCAAGGATATGATCATTGATGGAATGGTTGACAGTACTGTGTTCAATGC
GATCGATCGAAAAGATGCTTTCTAATAGATTCGAATGCGCAAAAAGGAATCACTAATAACTGCAGTTAGGACCCTcagtggtatgctgtggAAATGGTTG
GTGATGCGACAAGGTTTGAAGACGCTCCCGCGACTTTTAACAAAATGGTCACCTATCTTCTTCGTCCATTGAAAGAGTTACTTTGACTATATATTCGTTC
AAAGTAAAAAAGCGTTGAGAAGTCTGATTTCGATGTTCATCTTGGTCATCTGCGTCAAGTCTTCTAGATTATCCGAGAGCATTAGATCTACGCTACCCTG
AAAAGGGTATTTTCTGCATCAAATATCCCCGTTCTTGGCTGTTCTCTGGGTAAGAAAGGTAAAGAGTTCGTATAGATCCGTATAAAATGAAAGCTATCGG
TGATTGGCCTGTGCCAAACAATGTGAAGCAGCTGAGGCAATGGTCGGGCTTggccaactatttgcacaaatacacgcGCGATTATGCAGCGTTCGTGCGA
CCCCTATCGACTCTTTGAAGAAGAACGTTAAGCGGgaatgataaaaaaatcaccaaGCGGTAATAGTTGCGAGAAAGACCCGTCATTGCGATTGCAAACC
ACGAACAATCTTTTCATGTGGTCTACGATGCAAGTGATTATGCCATAGGTTGTGCGATGATGCAACACAATGATAAGGGTCAAAAGCGAGTGGTTGCGTA
TCAGTCGCGACAACTCCAGCCCGCGAAACATAACtccccagttcatgacaaatgGCCCTTGTAACGAAGTATACTTTAGTATAGTTCTGTGCGTTCTTGC
TTGAAAAGCATcgctttgcgatctatacagatcataccTCGCTGCGTGCGACTCCACATTTATCGCAGAAAATGGCTCAATTGTCGTCATTTCTTGCAGA
GTGTAAACTTCAAGCCGGGCAAGACGATCATCTTAGCCAATTCGTTATCAGGACGTCTGGAGTATGATCCAAGGTTCAGGAGCTTCATCATGCACGAATA
ATGTCGATAATGCAAAGATGTTCAAACGATCAGAGTGCACGAAACGACTACAGTGTGCGAGAAAATTGTCGGAGGGAACAAGTTTGATAAGACATGTCAG
GACTTGTTGAGTTATTTTAAAGATCTTTCtgacaaagcactgcaaggATTTCCTTCTCGCACACGATCGCGTGTTCCCGGTTTCGAAGTACACAAAAGAT
TATTGTACTATGCGGCTGAACATGAGGATACAGCAAGATTCTTGTTCTTAATAACGAAGGTTTGCGTCATCGACTTTTAAACGATTACCTTGACAGCCCT
TCGGGTGGCCATTTCGGACATAAAAAATGTTACTCGGGATTACAAATGGACACACAAGCATAAGTGGGTGTGCAAGTATGAGAGGACTTGTGAGATTTGC
CAGGGATTGAAACTATCGGGTTCCACTCAGGTCTCATTTCGGTCGTTGACAGTGCCAACTGACAGCTGGAAGTCTGTGACTATGAACTTCACATTCGGAA
TCTCCGTGCCACACATGGAGACAGTGGTATCCGTGTATTAGTGGACCGATTCAGCGAGACGGCTCATTTATTGCCTGTTTTAAGGAAAATATCGGCCGTG
AAAACAGCTtaggtctttgtagacgttGTTCTTGGTCTCCATTGCCTTTGTGCTGAAATCGTGTCTGACCGTGACATACGTTCCACGTCAAAGTTTTGGC
AGGCATGATTTGAACCATTGAGCACCAAATTGTCCATGTCATCAGCGGCACACCCTGAAATGGACAGTCAAACGGGGAGTGTGAATCATGTCATGGAGGA
TGTACTGCGCAGT