Description :
From Genome Similarity Track
Location :
Scaffold_4:317800- 319961
Transcript NameFunction/comments
Physo_128215hypothetical protein
Physo_128216reverse transcriptase

Sequence
2161 bases(100 bases per row)
GTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATCGACTTGGGCAAGTCTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAG
GGTCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTAA
ACACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCGTCATGGTGTCTTGCACCCTGCTGATTATGTTCAGCCT
GTCTTCGGCAAACGAGGAGAGTTGCTTCCGCAAAGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACC
GAAGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGGCAAAAGGGCGTAAGCCCGTCGATGCATGTACCGCATTGTT
GAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGTCGAGCGTGTCAGCACGCGATTGACGCGCTCCGTCT
GGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCG
ATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGCAAGACACAGTCCGTGAACAGGCGAGCGACCTCGTCGCCAGTGTCGGTGTCACGAACTGTAGCA
AAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACT
TCCAGCAGTCCGCTGGGGCCGGCAGGCTCTGGAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTAGCCCGTCTCGCACGTACGGACGTAGGTGGC
GACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCTTCTCACGGCCGAGATGGCCACTGGATGGAGCGTCGTGCGCCTCC
ATCAGGATGTCGTACTTAAGATCCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGGCCCTATAGTGGAGCAAACCGTCAGCCCACTCAT
AGCGGTGCAGCCTGGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCATCGTC
TCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTCGGGTTGGCGCGACAGCGCGTCGGCAAGCACG
TTCAACTTGTCTGGCTTGTACTCGACACGGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCGCCATCCGCTGTGAGAGATGCGGCGTGTTGACGGCAG
TCCGCAAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCAGGAGGTGCACTTGGAACTTGACAAGAGCGTACTTCATGGCAAGTAGCTCCTT
GTCGTGGACTGGATAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGCCTTCAACGTCGGCCTGCAATAGCGCACAG
CCCATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGGCGCGCGCTGTAAGCGCGCTTTGATGCCGT
TAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAGGGCCGTGCCAGCTCGGCGTAGCCTGCCTACAACAG
TGGTTGGGCCTCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAA
GGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGGCATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGC
TCACAGCCGTGAGTGGGATGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTCCACCAG