Description :
From Genome Similarity Track
Location :
Scaffold_3:3178- 8994
Sequence
5816 bases(100 bases per row)
AAAGCACGGCTCCTGAGCAGTATTAATGCTTTGAGAGCAAGCGCCGACAAGGCTGAAGTGCGTCTCGAACAGAAACTCCGTTATGAATTTACCAAATTGA
AGACCAAAGGCCAGTTGCGGGCGATTTTCCGTACGCTATACGCTGCGGCTGTGCCGCTGACTGCGAGTCAACATCGGGCTTCGGTCGTGGACCTGCCTGA
TGCGTTCATTACTGGTGAGAAGCGTGATGGGTAGCATGTTGACCCTGACCGTGGTGCTCAAAACATCCACGGCATATGGGCAATCTTGCCGGAGGGGTAT
CTCGTACTCCCATGATTTCTTAGACCCAGGGCATCCCCGCCACTTCACCAGTACTGGTATTGTCCATGAAGATGACGTTGTTGTAGTATCTTTTCAACAT
TGAGCTAAAGGTTCCCTTTCTGGTCAAGCAACGCCGGTGGCGGTCGGTGTGTCGGCTGCAGCCCATGAGGCTTTGGTTCACGAGGTGAACGGTCTTCGCG
AGACTTTGGGTCAGACCCAGCGCACACCTGATGCGGTGCAAGCTCGCTTGTCGACGTTTGGAACGAGTCAGACACGGATGGAGGTGCAACTTGACCTCCT
GATTCGGATGTAGCAGCCTGTGGCAAAGCTAACTTCCGTGGCGCAAGTGCCTCCCGATCAACCTGGGATGGATCCCGATACGGAATAAGGAGGCCAACGT
AAAACACGGGGTGTGTATGCAATTTGCGCGTTAAGTTGAGCGTATACGCAAGACCCTTCTTGGCCACGACCGTAAATGTTCCAATGAAGTGAGAACGCAG
CTTCGTCTTAAACACAGTAGACACTACATTTGTAGGTAGATTCTTAGCGTTTAGTAAGACTTGGTCACCAACCTTATAACTTTCAATACGGCGTCTGCCT
TTAGCATCTGCTTGGTGCTTCTGTTTGTCTTAGCTATGAGCTGTTGCGGCACGCACATGTCGTAAGTCTTCAATCGCGTTGTGAGGAACGCGCTATCCTG
TTTTTGAACAGTATAAGGGCTAATATCAGCAAGTCGATCGGATACCTCTCCCCCACCAAGCCTTGAGCCACGTAGTGGTAGCGTCAGCGGAACGCGTGGG
TGTGTGAGGCCGTTCACATAGAACGGAGTATAGCCTGTCGAAGCATGAACAGCATTGTTCATGTCGAACTCAAATATGGGGAGCATTCAGCTCCAACGCC
GATGCGTCTCAGCGCACACGCTGCGTAAGACGTCACCGAGGACGCGATTGACACGCTCAGCCTGACCATCGGTATGCGGATGATCCGCGGTTAACATGTC
TAATCTGGTGCCCAGCACTTAAAAGATGGGCTTCCAGAACTTGCTCGTAAAACGAGGATCGCGGTCAGAGACAATTGCCAGTGGCAGTCTGTGTTGGCGA
AAAAAAAAACACGCGATCAAGGAACAGCAATGCTGTACCTTCACCATCAATCGAATCCGGCACAGCCGCTAAGTGAGCCATCTTGCTCAAACGGTCGACA
AAGACCACAATACCTGTGTTGCCTTCCAAATCATTCGGTAGGCCAAACACGAAGTCCATGCTGATGGACTCCCAACACCCAGAAGGTAAACGCAAAATAG
CCAACGGCGCCGCCGCATGTGCCGAGGGTTTGACCCTTTGGCACGTCTCACATGTTCTTACATAAGTGCTTACCCATTTATAGATTTTGGGCCACCAATA
ACCCTGGCTTACCAAGCCGTAGGTCTTCTCACGACCGAGATGGCCGCTAATAGCTGTGTCGTGGACCTCATAGAGGATACGATACTTCAGTTCCTCATCA
TGAGGAACAATGATACGCGGGGTATCCGCGGCATCCGTGCGATAGCAAAACAAGCCGTTTTCGATAGAATATCGATGTAGCCTCGAACGCGAACGTACCG
ACAGTTTAATGTCCGACTCTTTAAGCTCATCGCTTCCAAGAGCATGTAGCAAAGATACACGTTGTTCTTCCTTGGCATAAGATAAACGAACTAAGTCAGT
AATTGACGACGACAAAATTGTAACATGAGCAAGGTCATAGTCAGGCCGTCGTGACAGCGCATTAGCCAGCGTATTTTGCTTTCCCGGCTTATAATTCACC
TCTAAGTTATATTCTGAAAAGAATGAAAGCCAATAGGTCATCCTCTGCGAGAGGTGAGGCGATTGGGTCGCTGTGCGTAAAGACGCATGATCGGTATCGA
CTACAAAATGCTTATAGCCAAGCAGATGAACTCTGAATTTGACTAGAGCATACTTCATAGCAAGCAGCTCCTTTTCGTGAACTGGATAGTTCTTTTCAGC
AGCTTTAAGCTGACGGGATTCAAAAGCGATTGCACGCTCGCGTCCCTCAACATCTGTTTGTAACAGACAACATCCAAAGGCAAAATCCGAAGCGTCACAG
ACGACACTGAAAGGCCGATCGTAATCCGGCGAAGGCAAAATCGGGTCGTGTAGTAGAATCTCCTTTACGAACTTAAAAGTGTCTGCTTCGGTGCTAGTCC
ATCACCACTCCACATCCTTTTAAGGAGATTGGATAGTGGCCGAGCCATATCAGCGTAATTCTCGCTATACACGTGCAAGTAAATGGCAAGGCCAAGCCAT
TTGCGTAGGTCCTTTTGATTCTTTGGTACTCGCCAATCTACTATGGACTTCACCTTTGCAGGATCTGCCCGAAGGCCTCACTTCCCATTGAAGCATCCCA
AAAATGGTTTCTCATACGCACCACAGATACATTTCGATGCATTAGCATAGAGCTTATTAGTGCACATGCACTCGAGTACAGCTCGTAAATGGTCGATGTG
GTTATCCACGTCCGACCTACCCTGTTCCGCCCCAATATGGACAAATATGTCGTCGAAATATGTCTGTGCATAAGCACGATGAGGGCGTAACATTTGCGTC
ACCAGATGATTAAAGGTAGCCAGGGCATTGGAAATCCCTTGGGGCATAACCAGCCACTTCCAAAGCATACCGCTTGGATTACTAACCGCTGTAAGCGGGA
TATCGCGTGCTCGCATGAGCAGTTGATAATAACCATCGACCAGATCTTGTGCATTGTACATCCTGCCATGTTGTTCTGAAGAACGTCCTTGCTAGGAATG
GGTGTTTGTGCAGGTATAGTGGTCGCATTAGCTTATAATAAGCATGCACAATAAGCCACTTACCATTAGGCTTTTTGACACAAAATTTAGGTGTGGAATG
AGGATACTTACTCTCCCGCACCATTCCCGCCGCGTAGCACGAAAGGAATCGTCAATGACGTCACACTGTTCCTTTGGTAAAGGCCACTGCCTTGCAACGC
AGTATTTGGTTCCAGAAACCAAGTCAATTTCATGACGTACGCCCCTATCGGGAGGTAATACAGACGGTGGATTATGACATGCCACATCTTGAAATTACTT
AACCAAAATGCACTAGGGATCTGAAGGGTTCTTCAAAATGAATGATCCACTTCTTGCACTAAGTGCCGCCTTTGTGCTTTCAAGGACCGTCTCATCCAAG
AGAGACGAGGAGTTCAACTCTTTATCGGGTCTAAGGACCACCATATCGGATAAGTCGCCTGCCTTCAAGGCCTGACTGAACTCATATATAGACACTTCGT
CTAGCTCTAACAGAGCAGTTAGCTATTGGAGGGCCGCAAGGCAGACTACACCATCCACGTGACCTGTCACTCCATCGACCAGTGTATATAGCTGATCTAT
AGTATGGCTTAGCGACATTACAGACGCTTTTCGTCTCGCAGCCGCCATTTGGCGTCGCCGCCGTCTCTAAAAAGAGGCTGAACTCTTCGACGAAGGTGGA
CCATTTCGTCCTACAAGGTGATTATCTTTGTCAACCTTAGCGTACTCTAAACAAGAGCTGATTTCATTACCGACATCCGGTGCAAAGTTATTAACTCGAA
CTCATCACTCGGCGAGTCATCCGCCACTGCACGTACATCATGGGAGTCTATCTATTGATATCTGGTTGTCTTGCCAACAACGCCATTACCTACATTCAGT
GAGGTGCTATGACAGCCGCCCTCACTCTGTGGATGTTCACGTGCCACTGCACATGCGTCAGAGGAGCCTAGCTCTTGATGCTGGGGCGTTTCGCCAACAA
TGTCATGACCGACATTCATTGAGATGCTATTTCAGCAACCCTCACTCTTATGATGTTTACGTGTCACTCCACGTATCTCTAAGGGTCACACCCTAAATGA
CTCGACCCTGGAGTCATCATACTATCAACATCCAGTGGTTCGTTGTAAAAACGAGTTCCACTTAACGGAGTACGTGCCGTTTCACTATTTTATTGACATC
AGAATCAAGTAACTCAGACATTCCAATGTCCAGCACACTAACTGACTCAGCCAGTGTCTCGCGCCAATATCGCTTTTTATCTCGCAAAGGTGGGTTCATG
ACTCTCCAAAGGTTCACTAGAAACATTGCGCGTTGCACCTAAGGTCTTAGACCTCCAATCAATCCATGACTCGCGGCGTTCCAGCCAGACCATACCAAGA
ATGAGATCATATCTCGAGTCCAAGTCTAGGACAAGACAGCGTTCAATGATGTTAACGTATAAAAACTATGCACCTAAGTTCAATGGAAGCTTAGGTACAG
TAACACGGACCCCCGTTGCTAGGAGCACCGTAATAACATACCTTCATGCGCTTTCAGCGCTTCAGCATACTGCTGACTTTCTTCAAGGGATCGGCGTCGG
ACATAGCTGCCCGATGCCCCTGAGTCAATTAAAATCGACCACGGCTCTTCAAAGCCCTTAACTGTTGCCAAGGCAACCAACACGCCTGAATTGTATTCAC
GTTTCGTGGCAACGTCCACGTGATCGTGTGGGCTAAGCTCTGTTCAGCTCTACCTCCTAGATCCTCTACGATGCCTAGTTCCTTCCCAGTACGGCACCCC
GCACTTACTGGGGAGTCGACGTGTCCCGNNNNNNNNNNATTCTGGTCATGTCAATTTTTACCGTAGCGAGCCGCTTTTAAAGTTAAACTCGGCGTCTAAC
GCTATGTCCACAGCCCCCATAAAGGTCGAGGGATTTATACCTAGCGACCCCAGTATGAAGACCTTCCTTAAAAATGGTTACACAGACTTCCTCAGGGAGA
GGATTTTACTGCATAGCAACGAGAAGAGTTCTCAGCTCTTGAACATAGTCCCATAACACTTTTCTCCCCTTGTCGAGAGTATAAGAAGCGCGAACGCACT
CGATATGCCTGATTAGGCAGTGCGAACATGCGAGACATGTGTCTCTTAAGCGAATCCTACATGGGAAACGCGGCGTCTACAGACGTATCACACGTCATAG
CCCATTCTCTGACTCTGCCGCCAAGTTTTGATATGGCTAGGCCAACTTGCTGCTGCTCGGTTCGCAGCATAGCGGCGCTCAAATCTCCATTTCGACTTCT
CGAATCCAGAGGAGGAGGTTTCTCTCTCTTTCCCGTCAAACGTCTTTACGCTCAGAACAAGCGGGCGAGCCTTAGGATCTTCATCGGGCATAGGGATGTA
ACGAGTCGGCATAGCCGACGCCACATGGTCATGGACTTGCCCGATAAACGTGGCTTCAATTTTCATAAAAGCTTCCTGCCGTGCGTTGAGCACTTCCGGG
CCTTGAGCCACAATATGGTCGATTTGTTCGATCCCCATCACCGCTCTCAGCTTGTCAAGCGCAAGGAATTGAGCCTGAGAGAGATGAGCGAGGCTTTCCA
TCTCATCAGAGGTTTCGTCGATTTGCGACTACGGTGTAGGATTTACTACGAGTGCTACCGAGTGTAGTGGAGCTACACAGCTCTTAGTCAGAGGAAGACT
TACGACTCTAAAAGTC