Description :
From Genome Similarity Track
Location :
Scaffold_399:3178- 25333
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_399-snap-gene-0.6EsV-1-12
Pytve_DAOMBR484maker-pve_contig_399-snap-gene-0.7Conserved gene of unknown function

Sequence
22155 bases(100 bases per row)
GAGGCTGCGATGGTGTGTTCACAAAGCGATTCAGTCATGATCCACTGATTGATACTAAAGTATGCGAGTCGATTTCAACGTACCATACTGAGAGTGCCAG
CAACACTTGCTCCACGCTGCCTTCCTGCACAAAGACGATTACCGCGCTCAGGAACAGCTTGCGCGAGAGGTCGACGACCTCGAACCACCAATACGCCTGT
GAATCTGAGGCAATCATGAATAGCCCATGTCTGTCAGCTTGGAAGGGTCAGCACGTCCAAGAGGGCAAGTCCCGTACATTCAGCGTAGATGAATCCTAGT
CGGGCCTGAACAGTAGAATCCTGACCGAAGCAACACATACACACAAACCAAATCGACAGGTCAGAACTGCAACAAGCGAGGATCTAGCCTATACAATCCG
ACAGCTGACCATCAAGTTTTTGCGCTTCATATATTTGGCCAGCTCTTCGTCTTGAACATCCCTGTTCTCCATGTCAGGTACATAGATACCTTCGGCGGCG
TGCTGCTGAAGTAACTCCTTGAGCCACTTCGTGCGCAGTCGTCGGCACTGTGGCTTCCGCAGAAGCCGTATTCTGGCAGCGACACCGCGGTCTTGAGCCA
GCCAGATGAGCAACCAGAAGAAGAACGGGATACCAATGACCCAAACAACGACTCCTGTCGCTGCCAGAATGCCGAATATGAACCAGGTGGAGTTGTAGCA
GACAATGCGACGATCTTGAACCATGTAATAGACGTCGCCAATCTCCTGGCAATTGAAAATGGCCAGTATTGTCTTGGAGACAGTCGGGTACAGGAAGAGC
GCGATCCAGCAATAGAGCTTCAAACACTTGTTTCGGTAGGTCAGGTAGTTCATGCGCAATTTCACACGCGCCTGCCACACTCGAAGGTTACTCCGAATCG
TTCGCTCCAGGATAACGCCGGATAGCACGTGCTGCTTGATGGGACATTCTTTATGAACCGAGCGGAAGACCCCCAAATACGGCGTCTTCACTTGGGACAT
GCCAAACTCGCGCTTCAGTCGGCGCATCTCAGCTAGAGCAGCACGGTCGGGTTGGTGGACGTTCTTCACACTAGCCGTGACGCTATCACTGGACGCGCGA
GCGAAACGGCGTGACCTCCACCACAAGCGGACAAGTACCAACGGGTTCAAGCTCTCCGCGTCATTGCGAACTGCTTCTCCTTCGCAGACCGGAAGACCAC
ACCGTAAGCAGTTGCGAGGGATGAGCTCTAGCTTCGAGCGATAGCTGCGAAGACCCGAGTAAAAGTATGCGGTGATGATGGCGAGAGCGATACCAACGAG
CGCTACCGTAATGCTGAGAGGCCAAACACACGACACTGTCAGTAAACAATCCTCATTTCGTGCTCGTAGCGCGCCGTACATGAAATTGAAGTAGAAGGTT
GTGGTGAAGATGCAATCGATTCCGGCGACCGCAACGAGATCCTGCCGAGAAGCAAATGCATTGGTTAGTTTCGCTCAAATGCCTCAGCCAACGTGGATAT
CGTACCAGGTTGAATTTGGCCGAAATGGACATGATATTCTGCACGTCCGGTGACCATTTAATGACAAACGTGTCGCGAAAGTTGCCGAATATCTGGAAGA
AACCCAAGAAAATTTTCAGCTTGCCGGCTTTGATCGGGAACTTGTGGTGTGGTGGGTCTACTTCGATTCCGAACAGCACTGCCGCAGTCTTCTTGCGATT
GCCCTTGAGCCGGTTTTTGCATTGCTCGACTCGGTCATAGAGAGCAGTCGACAGCCGCTCGTACTGAGCTTCGACGTACTCTATAACGCTTTGTCTCTGC
CTTTGAGTCGCGGCCGGCTTGAGCCGACGGTCAGCTTCGGCCTTTTCCAATAGCGAGATCTCGGTCATGTCTCGAAGGTACAGACGCACGCCTGCGACGA
CTGCTATGAACGCCAGAACCATTGTGATCGGAATCACAAAGTTTTGCCACCGAACGGACGCTCGAACTTCAGCGGTTGCCTCGTCACAGGCTAGCCAACG
ACGAGATATTGATGTGGGTCAGAAAGCACGCTATAGTCATTTCATGCGATGGTGACTTACGCAGGCAAGTGTTGGACTTCGTCTTCTTGTAGCGGTCAGC
ACAAACGGAACAAATGGCTTGATTGTAGCCCTCTGCACACGCGCTGCCAGTTGATGCTGCTAACGTGTGAGCCTCGATGGTAATGTCCTGTTGGCAAGCA
GACTCAACCTAATTGAATTATGGAGAAGGTTAGTTGAGCATTTGAAAGCAGGGATATCAGCGACGAAATCGGTCACGAACCTCGCACGTGTAGAATGCCA
TTCCGGACAAACACGAGAAGATTCGGTCAGCTGTCCAGTATTCCTTGAACCCGTTCAAAATGGAGCACGAGTTGATGATATCAGTTACGTTAGCGCCTGG
CATTTCTTCCGCGACCGGCACACAAGGGTTGTCGCTTCTCCACTTATCAGGATCACACTGCTTGGCGTATTTCGAGGAAGGTGCAGCGAACAAGTAATAC
CCTTCTATCGTGCGAGGCGACGCCGTTCCGACATCGCGAGAAACAGTTTCAGTCGCTCTCCTGGCCGACATGATGCACTTGGCTCCTGTTGGGCACGTGT
AGCATTGAACGCCGTCCAAACTGTTCATAGAACATAGTGAGTATTCAATAGCGATGCTGTAAACGACACACACAGTCGGGCAAAGTGTACCTGTACAAAT
TCTTCTGGCACCGCGAACACTTCCTGTGAGACCATGGCAGTCGAAAGGTCAGTCCGAGCATTCAGATCGCGTTACTGTCCAGTACAACGTACCCGTTGTC
TGTTGAGTATCCAGCAGCACAAGACACCATTTTGACGCCTTGTGTAAACGAGAAGGGACCGATGTTTTGAATGGAACACGACATTTTCAAGACATATTCG
TCGCTCCTCGGCTCAGCTGAGAACACTGCTCCGTCAAATGACATAACGCCGTCAACAGCATAAACGGAGTCGCGCGGTTTGAAACCGATGTACCCAGACA
AACTCCCGTTGACTTGGCTGGCCACGCTGCAGTAAGTCGTATCATCCAATACCTCGACCTGGCCGTATAAATCCACCGCTTTCAGGCGTGGCCAGACAAG
GGTTGTGTCTGCCACGCTCTGATTGCTTGCGTTAATCGTCTCGATCGATTCCTCGTCTGCTGGCTCCATCGTGGCTAGACCACTTGACACACTTGAGGGC
CACCACAGCACACTCACACTCCGAGTGTTGGTTGCCACATCATAAATGCTGTTGTCTATCATCGTGCAGTTGTTGCACGGATACACAGGGGACGACTCCA
CAATGGAATGCCAGTATATGCAACCGCCGCTCGACGCGTGATTTGTTTCGCACGTGATAGCCGTCATCGACAGATTCATAATTGTGTCATAGTAGAATGC
GCCGCCTCGCAACAACGCCGAATTGCTCAGAAAATAGCAGTCGTCAATGGAAGCGTTCGTCATGCCTTGAACGTAAACTGCGCCGCCATCACGACCAGTG
TTTCCGCTAAACTCGCTGCTACTGGCTTTGAAAACAGCATCATCCGAGATGTAAATGGCGCCACCACTCAATTCAGCTTGGTTCGTCGTAAAGTTTGCTT
CCTCTACAGAGACGGACGAGTTATCCTTGCAAGCAACTGCGCCTCCATTTACAGCACTATTTGTCGTAAACGAGGTTTGACTTGTGATGCTCACAGCAGC
TTTCATGGACGCCAAAATCGCTCCGCCCGATGTGTCAGCAAAATTTGATTCGAAACCGGAGTTTTCCAAAGTTGCCCGACCTTTTCGGTCAACATAAATC
GCTCCGCCGTTCTTTGCTGAATTCGAGGTGAAAGTGCAAGTGTCCACGATAAGGACGCCATCGATGGTAGCGAGTGCACCTCCTCCTTCGGTTCTGCCAG
TTGAGGTAATACCCCCGTTCGACACGAATTGCGTGTAGCTCGCACTAAGGTGTGCGTCTCGAGCAACGAATATTCCTTCATGAGCGACGAGGAAGCATAT
TAGCGGATACATCAAGGGTGAGTTGAGTACCGAAAGAAATACGCATACCTGCACCCAGTCCCTTCACGATGTTATTCTTCACAACGGCATCATACAGTGT
TACTTCGATTTGATCGCCCGTGTTCAAGTAGATAGCCCCGCCTGAATCATCTGCTGTGTTGTCCGATATTTCGGACGTCACCACAGCAATGCGAGAGCTG
GTTTCTACATAGATCGCTCCGCCCACATTCATGGACGCTACCACAAGCCATAACTGTCAGTACACACTAGATACAAGACAACATGCCAAAATACGTACTA
CTCAGTGTGATCGTGGAACTCTGAACATACGCCTGCGACCCTCCAGACAGACTCAAGCTGCCTCCAGCTTGAGATGCAAAATTCGAATAGAACGTTGATT
CCATTGCAAGGAAAAGCGCATGATCCCGAGCGTAAGCCGCGCCACCAGATTCGGCTGACCCATCGCTGAAAACACACTCGGTAATTTGTGCACCAGTGTC
GCTGTCGGACACATAAAGGAGCCCCCCTTGCTTAGAAGGCATCGTCCCACTTTGAATTGCTTGCCACCCAACATAATCTGACCCCGTCAGATCCTTAAAC
ATCTGCGACCAGGTGGCCGAAAACCCATTGTCGTTTCCAGATACATTGCACAAGTTCAAAGTAGTCTGTGATGCGGATAGTCCAGCGACTGAACCGCCAT
AATATGCCCTGTTCCGCATAAACAAGCTCGTATAGACATCCGATGCGCCACCGGCTTCCGAGTACAGCCCACCGCCGTATCCTGATGTCGCATCACCGGC
CCTGTTCTCGACAATCAAGGTGTCGCTTGCAGAAAACTTCGATGCACTCACGAAGACAGCCCCTCCGTTACTAGTTGCACTGTTGTTGTACAGTACGCAA
TTGATGGTGGAAGTAAGAAATGCTGAGCTCGTGCATCCAGTCCAGACACCCCCTCCATAGGCTGCTTGATTGTTCAGGATCCCCACGCTTTCCAGACCGA
CATTAACTTGCCCAAACACAGCAATAGCTCCACCCTTTGCTGCGTAGTTGTTTGCGAGAACCGTGTTCGTGATCGTGGCGCTCCCATCACCAGTCACGTA
CAGCCCTCCTCCCATTCCGAGGGTAGTATTTCCGCCAGTGATGACCATCCCACTGAACTCACACGAGTAGCTGCATTCTAGTGCTGCATTGGCGCCATTG
TCCGGAGGTGCTCGAATCGTATTTGAAAGAGCAAGAGACGCAATAGCACCAGCTTGATCCAGCATCACCAATTTGGCTTCTAGAGAGTCACTGATGACGT
AGACGCCACCACCCATCTCGGCAATGTTTTCAGCAATGGACACGTTCGAATGGTAGACGAGGCTGTCATGTACAGCTAAACCACCACCTGATTCGCTGGC
TTCATTTCCTGACACGACTAGGTCTTGAACCACACACTCGGAATCGATGCCAATGTATATCCCGCCACCAACTGTTGAAGCTGACGAATTCTTGATGGCA
ACCCGTGAAATGGTGCAGGTTTTCGCGCCTTCAGCGGCTATTCCACCGCCCAAACTAGCCATGGATCTGTAGACTTGGACATCACTCAATAAAGCGTCCA
CACCGTCAATGAAAGCACCACCACCCGCATAATCAGCCGTGTTATCCACCAATGCTCCAGGTGAAGCGCCATAGTTAGTTGTGGCGGCCATCAGCGAAGA
GGAGTTCAGGTATACGCCGCCACCGCGACGCGAGGAACACTTGGAAACAACCAGGTCTTCGACCATGATCGCCACATCTTCTGCACTCATGCCTCCCCCA
ACTCCAGTTGAAGCAGTACAATTGTTAATCGACACATTGCGCAGTGTCAAAGAGCCAGACGCAGCGGCAAGTCCACCACCTGCGGCATCAGCAACGTTAT
CCATCAGAATCACACCCTTCAGCTTTGCTATCCCGGTAGTAGATACACCTCCACCACTCTGCGCCGAGTTTGATATCGATGTCGTCGTTCCCGACAAATC
GGTATTCACGACATGAAGGCCACCCCCACGGATATCCGCCCTGTTGTTTGAGACTGTTACGCCAGTGGAAACGACTGTTGATGCTTCAGTAAACATGCCA
CCCCCAGCGCTCGCTGCGAAGTTTTGTCTGATGATCAATTGCTCAAGCTTGGTGAGCTCGGACTCGGATACAAAGATGCCCCCTCCAAATTGGGCAGAAG
AGTTTTCGACTACCAAGTCCCGTATCTCGCTCGGTTCTCCAACAACGTAAATTCCGCCACCAGCAACCGTTGCATTGTTTTCTCGGAATACCACAACTTG
GCCGCCACTGCTTATGCTTGAGTTCACACCTCCTAAACTGCTCGAGTTGACGAAGATCGCCGACCCATTAGTGGCTGAGCTGCGCGTGATGTGGACCGAA
TCGAACTCGATATTGCTTCTGCCGCCAACGTGAAGTCCACCACCAAGTGGCGCGTGACAATTGACACAAGTTGTTGAAATCACAGTCGCGGAACTTCGAT
CGAAAGCTCCGCATCCGCCCATGCCTGAAGCAGTCGCATTATATACAGTAACGGCCTCGAGTCTCGCCGATCCTGCTGCATCCACGAATAGTCCTCCGCC
CGTCCCTGACCAAGGCAGATCATTATGCATTAGTTTTCAAACTCCGAACAACGACAAAGTCTAGTCCAGTCAGTTGCTCAAAACTCACCTGCGGTACACG
CAACTATGGCAGATTGGTTATAAAATGCAATCCTTGCAGAGGCATTCGTGTAGAGTCCACCTCCAGCATTGCTGGCATTGTTCGATCGAAGACTCGATGA
CGTCAGGTTGAGCACGCCAATTTGCAGTACTGCGATTCCTCCACCGTTTTTGGATGCGTTGTTGAAGGCGATCGTGAGCCGAGTGATGTTAGTTGCTGTG
CCCACAGTTGCAATTCCTGCCCCTTTCGCTGCGACGTTTTGACGAATGCCCACTCGATCCACTTCCAACGTGCCATTCGAGTACACCCCGCCTCCACTGT
CGGTTGCGTTATTGAGTTCGACTGTGCTGGCGCTGTCTCCTCGAATGTGCACTTCGTTCTGCGCGAAAACCCCACCGCCTAGCTCCGCGAACGATTGTGA
AATGGATGAGGACCGAAGTATCACAGTCGACGAGTCGAGAAACATTGCTCCGCCTCGCGAGGCAGAGCAGTTCTTGACAATTGAGTTCTCGAGTGTTACT
GTTGATCGCGATGCAAACACTCCGCCCCCTCCAATCACTGATACCCCACCGGCAAGTTCCACACCTGTGCCAAACACAGCCCCGTCCACAACATTGATTG
CGGCACCTAGCGTGTTTGGTGTCGTCATGTTTGCGAGAACCAAATCGATCATGGTAACACTGACTCCAGAAATGGTAAAGCCGCGGTATTGTCCGAGACA
ATCGATGCGCGTCTTTTGACCGCCAGAAAGTCCACGTATCGTGATGTTCCCTGTAGAAACGTGAATGTCACAGTTTGAAGCTCCTTGGTAGATTCCGGGA
TATAACAAAATTATCTGATTGGGCTGTGCGAGCTCGATCGCGTGCCGCAAAGATTGAAACGCTTTCGAAGACTTCCCGGCAGGAGAGGTAGTCATGCGCT
CGCCAGTCCCTCGAGAGTCATCGCCATACATACTGACAGCGATCACGTTGCTTTGATCAAGCAAACAGATTGGGTCGCAGTTTGCTGTTTGACACGCCGA
CAGGTCGTCAGGACACAACGCGACGTTGCCACAGCTCTCGCCAACGTAGCCAGAAAAGCAAGCGCAAGCATCGTTGCTGCATACCCCATTGGCCGAACAT
ACTGGAGACCCAGGGCACGGGACATTGGTGTCCAGGTCCGAGTCGTCAATCTCGTACGTCATCGCAAAGCCAGCGAACTTTGAACTTGCATCCGAGAGAA
AGTCAACCGTGATCTTGTCAATCATTGGACCGGTTGTAAGCGAAAATGCACCGTCGCGCCGACATCCACCCGACCACAGCGTGCTAGTCGTGCCGGCTTT
CGTGACACTGACAGTTAAGTTGTCGTAGTCGCATTCCAGCCAGAATTCGGTTACCTGAGTGTGACAGGCAAGCATGTCTGTGAGTATCGTTAACAAGCAT
AACAGCCCAGCAGTTCAGCAAGTATTGGTCGCGTACATTCAGCAGAACTCCCGACTGATCCGTCGGCCAGACAGTCCACCGTCGCTGAAAGGAGTTATTG
TAGTTGTTCAGACGAATAAGACCCTTCGTGCCCTCGCACTGGAAGTCTTCTGATGCTGTCAAATCGGTCTTGTGCTCGGAAGGATCGCTTAAAGGCGATA
GACTGCCGTCCGCGTAGACGACCTGTATTTGATAGGTGTACGTTGTGTCCAATTGAACGGTTGTATCTTCCGCAAACAGGTTCGTTCCGTTGTATATCAG
CGTTGATTCATTGCGATAGAGCAAATATCTCGCTGCCGAGCGAGCTTGATCCCAGTGGATTACAGTCATATTAGATGACACTGTTCAACAAAGGACAATT
TAGGTGAGGATGAAACAAAGCAACGATGACGAAGACTGGCGTACCGCATCCAATAGTCGGCTGAGCGGGCTGGTTTGCAATTGTTGGTGTCGTGAAGAAC
AGCCTGCTGCTCGGTGTTCCCAAAGACCCATCAATCGTGAGCACAGTCTGGACACACACAGAATTATGTCAGTGCGATATCAACGCTGAACACTATCAGG
GTTTGGCACAGCAGTATTCCTACCACTGTAGCGGCGTATCGAGTTGCAGGTGTCAGCATGTCGAGCGTTGCGTTTAGCGTATTAATTGGCACTTTAGCTG
TCACGACCATGGATGGATCCGTAACTTGGACTGCTTCAACAGTATAGAGTTCGACGAAAGTGCCTCCAAAATCGGCGCACGGGTCCCACAGTAAAAGAGC
AGTTGTGTTGGTCAGCGCGTCGATTGCTAACTTCTTTGGTGCTTGAGGCGTTGACGGCATGCCAGTGCTGTAGATTTTCGGACTGCTCGGGTTCGATGCG
CCAAACGCATTAAAAGCAGTCAGAGTGATCGTGTAGTCAACCATCGGAAACAAATCAGTCACGGTGCAGCGCGAGATCAAGCCCTCGCACAAACCAACGA
CAGTATCGCCATTTTTCACCAGTAGACGGAACGATGTTACGGGAGTTCCACCCGTGTCGACAGGGTTTTGCCACGCTAGATGGAGCGATCCGCCCGTAGC
GTACTCAATAGTCGGCTCGCTTGGTGTGCCAGGCACAGAGATTTGAGAGGTCGCTCCGGCTGCGTTGACCGACTCATTGCTTTGACCCGCATCGTTTGTG
AGAAGAACAGAAAAAGAGTAATCTGTTGTGGGCAGTAAACCTCCGACGAGGATGGATATCGAGTAGATCACATCTTCAGCCAAGCGTCGGCTTGTCGATC
CACGTTGCGCCACCGCCTCAAGTCGCCTACCCGAGCTCTCCGATGACCCGATGCTCGACGACTTGATTGATTTGGTAGCGATACGAATGCCATTCGCATA
GACCAGATATTGCAACTGCTCTAGGGCTACTCCTCCTGTATCTTCAGGAGAAGGCATGGCGAGTTCAGCGGCTCCCCCGGACGATTGAATCACCATGATA
TTGCCCGGCTTGGTCGGTGGGGTCGTATTCCCGGTCATGAACGATTGCGATGGCGCGTCAGTAGCCTCTCCGAGATCGTTGATAGCATATACTGAGAACA
AATACACTCTGTTCGCCAGCAGACCTCCAACCTGAACGGTAGTCGTGAGAGTTTCCTTGAAATGCAGCTCCTGTGTGCTTCCATCAGTTGCGTAGACGTT
GTAGCCTCTCACCGCACTCCCTCCGTCGTCCTCAGGCGCTGTCCACGAAAGTTGAATCATTCCGCCGGTGGAGCTGTCCATCGACAACTCGCTGACAGGG
CCAGGCACGGATATGTACGAGGTTGTGAAAGTATACTCGCTTGAATTTGGTGAGTAGCCGATCTCGTTCTGACACGCCACCATGAACTTGTAGTCTGTGG
ACTTCGTGAGCTTCGTCTTCCACAGTGAGACTGCGGTGCCATTGTAAACAAGTCCCCAGACAGGATTGTTCAACGCGTAACTCATGTAGAGTTGGTAATA
GATGGGACCAGCGCTTCCAGTGTCCATGGGAACATCCCACAAAACACTGATCCCGCCGCCAGTAGCACCGGACGAACCCATCCAAGTCACTGGACTGGGA
AGGGTTGCTCCTGTCGTCTGAAACTCGGTAGCCTGCACCGTCAACGGAGTAGAGTCCGGGCAAGCTGACACGACATTTACAGGGATGTAAGCGAACGAGT
ATGAGGTCAGCGGGACCAGTCCGCCGATCTGAACAGTGACACGCAGCTCGTATGGTCCACTGGAGAGATAGTCGTAGAAGCTTCCTTCCACCTGTCACAC
AAGGTGGACAACACTGTCAGTGAACCTAATAATTAATTGCAAGGCGAGTCCTTTAGATATTGGAGAGCGTACACGTTGATTGTTGATGTGCAGCTCGAAG
TCGCTGATTTCGATACCACCTGAATGAAGTGGTCAATCGAAGCTGCGTCAGTTATCAGTGATAATAGGAAGCCCATCATCATCGTCAGGAATCACCTGTA
TCGTTAGGCGAGAATAGTTGAATGTGCAATGATCCGCCGGTAGCATTGATTAGCACTGGCGTTGGAGGTTCGCCCGGCGTTGTTGGTGCTTTAGTTGATA
CACTCATCGTTGGGCTCAGATCTCCTCGAACAAAAGTATCAAACTCGTCATCACTTCTCAATCCCGCCTCAACCACGGCGCTCGTGAAAGCAGCTGAAGT
ATTGTAGAAAACGATCCCCGGAGTGGGCTCTCTTGACAAGTCAACTTGGAAGATATAGTCCTGAAACGAAAGGCACAAAAGGTAAGATAAAACCCGCTGA
TTGCAGCATCAGCACACTCTTACTCCGTAGTCGATGTTGCTGATACCTGGTATGGTCGTGTTTTCGTTTTTGAGAAGACCAATGCTGAAATTTGTCGTGT
TGAGAGTCCCGATTCCCAACGATTCCATATCGCGGGTTAACAAGGAGACCCCCACAAATTCGTAGTTTGTGTCAGCGCCGAGACGGAAAACAGTTGCACT
CGAGCGCTCGACCAGTTGATATGCCTTTTCAAATAGACCGCCCGCGCTTGCATTGCGGTAGTAGATCATGTACGTCAGGTTGGCATGACCACCTGTGACA
CGTCGCAAGCCAACCAAATCACAAAGTTAGCTCGGAAGTATGGAATAGGCAGAGGAAAGACATCGTAACCTGTGTCAACTGGGTCGTCAACGAGAAAGCG
AATGGAACCTCCAGTCACCGCATTTTCGCTCGCAGATAATCGCGGCGGACTCGGGCGAGACAAGTCGCCACTTGAGAACAGAAACTCGGGAGAAACCTCT
CCATACCCAACCAGGTTGATTGCCTACAGCGCCAAAACGAGTTTCAACACGTTAGGAATGAGTCGCTAGGAGTAATCGATGCGCTATGAGTTACCCTGAC
GACAACCGAATACAGCGTTTGCGCGTTTTCAACCCCTAACGCGACGATAGACGTATTCGATATGGTAGTGATTGTCTGCAACGCAGAACAGTGTCAGCCA
CACCAAACATGGATACCCCAGTGTGAGCTAAGCAGCACCTCGTTGGACGATTGATTGTGTGGGGTAATGCCAATAGCGTATCCGAGGATATCGGCACCAC
CACAGTCTGCCGGCTTCTCAATCTTGATTGTCAACAAACCGCCAGTCGCATTAATTAGAGCAACACTTGTGACAGGACCGGGAGCGGTGAAATTGGTTGT
TGATTGGTAAATCGGGAGCGATAACGTCCCGGTGCCAATAGAGTTCACAGCTGCAATCTGAATCGAATAGTTTGTCAGTGGCGAGAGAGACCCAAACACC
ATTTGCGTTGAGTTATCTGGAGTCAGGATGCTCGATTTGTTGGCATCTGACGCGATAATGAGGCTATAGCGCAAAATCCACAGCGTCTGACCACCGAGGT
TAAGGGGAGGTTCCCAGCCGACCGTAATCATTCCACCTGTTCTATTCAGCGTCTCTATTGTTCCAACCGGTCCTGGAACAGATTTGTCTCCGTCATCCAT
AATAGTGATTTGCAGCACGTTGTGCAAACCAATGCTTGCTCCGCCCGCTCCAACACGAAGGGACAGGTTGAAGAAGAGGTTTGGATAACTGAAATAACTG
TTGTCTATCATGCGAACCGAGACAGCTGCCTCGGTTTGACGATCGGAGAATAGAATCGACGGCGTCAACAATTCGAAATCAACTCCAGGCTCCGCTGTGC
TCGAATTCCCATCGACGGCTGCAACCTCCACACTCACGTTGGAGCTTGACCCGTTTTGTCGGCGAAGCTGAATCGAAGTGACATTGCTGTTCTCAAGGAT
AGCCATTGTTGGGACTTCGAAATCGATCACACCGGCGTCCCCATCGTCCAAAATCCAAATGGTCGCCCTACTTGGCTCAACTCGATCTGACCGATCGGTT
GTATCATTGAGTGTCAGCTGGATCGATTTCGGTTGCGGGGTATAGACGTCATTGTCCACAATCACTATCGAAAACTGCTTCTCAACCTCGCCGTCATCAA
ACACAAAAGTCCTGTCGCCTTCGGATGGCAGGATAAAATCTATCTCGTTCATCGCGGTACTTTCTTCGCCGAGATCAACCAAGCAATTGATCTGGCTAGA
GGTTCCATTGATCCGAGCAATCCGGATAGTAACGGCAGAAGAATTTTCGTAGATGCTAATGTTGGTTGCTTCAAAGACGACTAGTCCGCGCTGTGCCACG
TCCGTTGCGACCGGACAGCCGCTGCTCCATTCGCTGTCCCCAGCTGAGTTTCTCGCTCGCACTCGAACAACGTACTCTGTAGATGGATACAGCCCGGTGA
TCTCAGCAGTCAGATCCGTTGTGATGACAGTAACTGTAGTTGCGTTCACGATGCTTTCGCACGATACTTCGTAGGAAACGATTTCTCCACCCATGTCAGC
AGACGCGCTCCATCCAATTTCCACCGAGAGGGAAGTCCGCCTCACGACTGTAACATTGACGACTGCGGAAGGGATCGTGGGACTGTCAGTCATTACCAGT
GCGGGTTCGCTGCGATTGCTCTCGCCAAGGCTGGCCAAAGACACAGCCGCAACCTGAAACTGGTAAGTGTGAAGAGCCAGTAGATTGCCCAATCCGACTT
GTGTTGAAACATTAGTTGACACACGCAACTGCTGGACACCATCTTGATAAACGACGAGCTCCGTGATCGGTGCTCCACCATTGTCGACTGGCAGATAGAG
CTCGAGAATGACGCTCTGTGCTGTCTTACTAACCAGTCTGGGTGGATCTGGAGCGGCGGGAGGTGTTGCGTTTCCATTCGCCACCGTGACTAACGCAGGA
ACGCTTGTGTTCACAGCTGTGACCGCGGATACCGAAACATTGTACGTTGCCATCGCTTTGATCCCGAAATACGTGTGATTGACTGCAGGCGTCAACAATT
GTTCAATGAGCTCTGAATCGGAGTACAGTCGAAAGTCGAAGCCAACCAGCACTACACCGCCTGTGTCTCCAGCTGGCTGCCAGCACGCAGTTAGTTTCCC
GCCCATCGTGTTTACTCTGAGTGCCTTTGGTGGGTTGGGTGCGCTTGGAGCTGTAGTTGACACTACGAGACGGGTGCTTGGCCCTCCGGCTCCGATTGAG
TTGGTTGCGCACACATAGTACGCATACTGTTGATCAGCGTACAAATTAAACTCATCCAGATAGGTGACGATCGATCCTGAGGCATTTGTTTGCGCTAACA
GAGTCCCGTCGCGAAATATCTGGTACGCCAACAAGATGTCTCCACCCGTGTCAACCGGCGCGTTCCACGAGATCGTGATCGAGCCTCCCGATGCCCCAAG
TTTTGTGAGGTTCAGCGGGCTACTCGGTAGTCCAAGACCTTCCGACGTACGCGCAAACACCAACGCACTCATTGTGCTGGATCCGTTCGAGTTCCACGCA
GTGATTTGGTAGCCATACGATGTGTTTGGCGTAAGACTGCCGCGCTGAAATGCTGTGTTCGTCCCGTTGTATACGATGCTCAGATTGTCCGAGAAGACAG
TGTATCCTAGGAACTGGCCCCCGCCAGTGTCATCTGGAGGCAGCCACTGCAGTGCGTGCATTCCAGGAGTCTTGACGACGACGGTCAGATTTCGCGGAGT
CTCTGGCGGGGTGACTGTTGCTGTCTGCGCGTACAATGGGGTGAACGTCGAATAGTAAGAAAAGTCAATACAGGCGCTGATTTCGTTGATCCCAGCAACA
ACAAAGCCGTAAGTGATTTCAGCCGTCAGCCCAGTCACTTTAGCAGTGACACAGGCTGAAGATCCGTTGAGATCGCGTAATGACATCTGAAATTGCTGTC
TCACTTCGCCACCGACGAAGTAGTAGACATCATACTTTTTGATAGTGCTTCCTCCGTTATCAAGAGGAGGCAACCACTTCAACGAAATAGCACCGCCTGT
TCGATTCAACACCGTCAAATTCCGAGGTGCATCAGGAGCAGACAGAAATGATGTTGTCGCGACAGTCACATCGCTCGGCTCACTCACACCCTGTTGGTAA
TACACACAAAGATCCAACACCAATCAGTTCCATGGTAATCTACAACACCCAAGCGTTGCAGAGACAAGACAGCACGTACAGCATCATTGACGACTAGGTA
CTTAAGATTGTACGTCGTTGAATAAGTCAGTCCGTTGATCACATACTGGCGATTGTCGCCCGTGTAGATTTCACTGAATATATTGGGAGATTGGGGGGAT
GCGAGGAATAAGCGATACGTTAAAGAGGACAAGCCTCCGGCGTCCAACGGAGGGTTCATCTGGAGTTGTAATGAACCGCCTGTCGCGGTCAGTATCGAGA
TTCCCAACGGTTTTCCCGGAGCGGTCGCAGTGCGCGTCGAAAACAAAACTGGATCACTCCACAATCCGATCAAACTTGCCGAATTGACAGCTGCCACTGC
AACAGTGTACTTCGTCAGGGCGAGCAGTCCGTAGAACATTGCTTGAGTGTCGATAGTAGACTGCGACGCAATGATAGACCCGTCCGAACCGTTTCTCAGA
GCGACAGAATACTGAAGAACATCGGCACCGCCAGCGTCAACTGGTCGAGTCCATCCGATGGTGGCGCTTCCGCCTGACCGAGCTGTAATCTCGACATTTC
TTGGCGCAGAAGGGGGAGTTGGGAGTCCCATGGTCACCACAACCGGGCTGGAGTAATTACCAACTCTCTGAGTGGTTCTCGCCAACACGAAGAACTGGTA
CTCTGTGAATGCATACAAGTCCGCAACGATGATTGCTGTTGTCAGGGATGTCAAGTTTTGCACCGATCCGGATATAGACGATACCACATTGATATTATAC
GACGTGATGCTGGCGTTCGCCGCCCCAGAGTTGTTTGAAGCAAGCCACGAAATGTTTGCACTGCCGCCAGAGAGAGCTTTCGCCGTGATGGCCGTGGGAA
CACTAGGCGAAGAGACGTCTCCATCATCCAAGATGTCAACAATTGCTGTCCGCAAGTCTCCAACAGTGGCACGGCCGCTAACAACAGCTAAGAGAACACC
AAATTGCTTGTGCGGTTGAAAGATCGAGTCGTTCGTGATGCTAATGACGATAGAAGCACGCGTCTCTTGATCAAAGAACTTCAACGGAGTTGACGGTAAT
TGATAGTCGACATTCTGTACGCAGTCTCGGTCTGGAATGTCAAATCCCGTGACGGCAATAGCAACATTGCCGCTGGCTCCACCGGTCCTATCTACCGTGA
TGGTCACGGAACCTGCCGATTCTAGCACAGAGTATTTGGACTGTGTGAATTGGAACACACCAGCGTCGCCATCGTCGACTATCGTCACATTCACTATGCT
CCGCGTGCCAACCGTCGCGGTTTGGTTACTCGACTGCTGGATAGCCACAAAGAAATATCTGTCTGGGTCGTCTGTGACGTTGTTGTTGATGATACCAATT
GAAATGTTCTTCTCGACAATTCCGGAACCAAAAAGCAGAGTGTCATTTGCAGCGACATAGTGGATGTTTCGCTTGGCAGTGCCATCGATTGTGTAATAAG
TACACACAGTCGGCGCGCTCCCATTGCTTCGTGACAATGGGAGTTTAGCAAACGAATCGGCTTCTGACACGTTCAGTGAGACGGTCGAGAACTCAATCAC
TCCTGGCGACATGGCATCAGTCGTCACCGATAAATTGCCACTCCAGTTCCCATTCCCAAATGAGTTTGTAGCTTGAACGCAAATCGTATATGCTGTGGAT
GGAATGAGAGCCTCGAACGAATACGGACTGGTAACATTGCTGCCTGCCGAAATGGTCTCGTTGCTTGAACTCATTTGGATACTGTAAGTCAGCGGAGTTG
GATCTCCGCCAGAATCTACGGGCGACTCCCAACGTACCCTGATGCTTGTTGGCGATCTGAATTCTAGCGCGAGACTATCGATCACTCCAGGTTGCGAGAC
GGGACCGGTGAATATTGTGACTGAATCACCGGCTTCCCCTTCACCAATCAGATTCACTGCGGTCGCCGAGAAACTGTACGCAGTCGAAGCCACCAAGCCA
ACAACGTCATATACAAGCTCAGATTGGTTAACCACAGCTGCTCTCGTCCCATTCACATACACGATGTAGGATAAAACCCGACTTCCACCAAAGTTCGCTG
GCGCTGTCAGCTTCAGCTGAACTCGACCGCCGAATATGCTGACCACGCTGGGAGCTGGTAGATTTCCTGGTGGCTCTGCAGATGCAGTCAGAAAATGGCC
GTATGCCCAGTCGCTGGATCCCACGTCGTTCGACGCGAAGACCGCTACGTCGTAATCGGTGTCTGCGTAGAGACCGTAGAGCTGCTGACTGAGCTCGAGA
CCAGCGTAAGACGAGAACAGAACGCCGTTGCGCAATAGGTGGACTGAGAAATAGCGCAAGGGAAGTCCGCCAGTGTCTGCTGACGGCGTCCACATTACGA
CAGCACTTCCTCCTCGAACATCACCGATTGCGACAAAAGGTGTGGATGGGACAGTAGCAATGCCGCTCCATGCAAAGATGTCCGCCAGCTGCTTTCCGGA
GTCAGCCGACGTGGCAGCAGCCACATTATACAAGTACACTTGGTTGGCAGAAATATTTGCAGAGTCGGTGTAGTAGGTGCGGGTGCCTGTCGAGGCCACA
TTTTCGACCCAGGTTCCGTTGCGAATAATTGTGTAGTATTGGACAGCGACGCCACCAGTATCATCAGGGCTATCCCACGAGAGTATGATCACGCCGCCTG
AAATCGACGGAACCTGCTTCAAGTTCTTCACCGGTCCAGGCGAAGTTGGCTCCAAAGTAGATATTGATAATTGAGTCGAGTTCGCTCCGGGTCCAATGCT
GTTAACTGCACAAATGGTGAATTGATACTCTGTCGAGGCGTCCAGCCCAAATAGGACTGCAGGCGATGCGTTCACGAACATGGGTTCGAACTCTGTAACC
TCGTCAGCAAGTTTGCTGACAAATACAGTGTATCCGATAATAAGTTGCCCTCCTGTAGACTTGGGCAGATCCCACGCAACAGTAATCGATCCACCCGTCA
CTATCGTTCCGCGTACATTCTTGGGCTGCGACGGGACAGCCGCGCTGTCAGTGGTTATGTTGAGTACTTCGCCTTCTCCTTTCCAGTCTCCGTAAAAGCA
AAGCGAGCGGTAATTCAATGGGACAACACTAAACCCATAGTTAGTTGCGGCAGTGAGCCCAGTCACCAACGCACTTTGGTTCAAGGACATCTTCCCGTCA
TAAGCGACTGTCGCTGTGGACCAGGTTCCGTTCCCGAGAGAACTCCTCATCCGTACTACATATCCCACCAGCTTCAGCCCTCCAGTGTCCTCTGGGGCCC
CCCAGTCGAGCGTTATCTCTCCGGGATCCTCGTCGGCAAGCTTTGGTGTGTCCATACGAAAAGGCGGAGTCGGGTCTGATGTGAAATAGCGTGCTGCTTC
GCTCAAAGGACTTGATCCCTTCAATCATAAAGAGAAAGTGAGATATCAGTCTACAGAAAATACCCAAGGTGCGTGTCCAAACAGCAATGTACTTACCTCG
GTATTCAGAATCGATACTCGAACGACGTAAATTGAGTTCGAAAGAAGGCCGTAGATCGCAGCAGACCCGACAGGGCCATCAGAAGCGTTTGGTTGATCAA
TAGGCATGGTATAATTACGATACAGTATGTCGCCACCAGTGAGCCGCGCCACGAAGATTGTGAAAGAGACGAGAGGGACACCGCCGCAGTCTGTAGGCGC
ATTTATACTGAAGAAGAGCATTCCTCCTGTTGAGTTTACCAGCGTCGGAGGTGGCGGTGTGAAAGGAGGTGTGCGGATCTCAGTCATTGTATTGAGCATT
GCAGCCGAACTCTCCAAACCAGCCTGGTTGGCCGCTGAAATCGAAAACAGATACCATGTCATCTCCGTCAAGTCGCTGATGTTCGCCTGTACCACGTCGC
TGTCCATCCTAATAGTGCGTGTCGCTCCTGTTTCCGGAGCATTGATAGTCAAAACGTACGTAGACAGAGGTTGTCCACCTTGATCGAAAGGAGCTTTCCA
CCGCAGCCTCGCGAATCCAGCAGTCACAGCATCAACATTAAAATCTTGTACAGCGCTTGGTGGAGTAGCTCCAGGCGTTGTAACCTGAAGAGTTGGACTC
GTTTCTCCTCGTCCTAATTGGTTGACCGTAGCAGCAGTGATGTCGTAGACGGTGTCGTTACGAAGCCCACCCATACTAAACGAAGCACTCGAATCGTTCA
GATAGGCTGTCTGGACGATGCTACCATCAGCCGTACGGACTAGTAGTTCGTAGCGGTAGAATTGCGCTGTGGGGCCGCCGAGAAACCAGCGTGAATCCAC
AAAAATCAGGAACATACCGCCGGTGACAGTGTTGACCTCCAAATGCGGATAACCAGGAAGACTGGCGTCGCCCTTATCCATCACAGTCACTGTCGAATTG
GTTGACGAAAGGACCGCACCGGCTGTAGCGTTCACCAGTGTCAACACGAATGAACGCATCTCGTATTCATCACTGTCTTGTATCATCAACGATAAGGTTG
CTCGTGTGTCGTCAGGGCCAAATGTAACCGTGCCATTGACTTGGCCTTGGACAAGCGCTGGGGAAAGCGTCGATTGCACGAATATCGCGGCAGAACCAGT
CGAACCACCAACACGTATAACAACGACACCGTACATTCCAATTGCCTCGGGCACAAGTATTTCAGGTCTCTCGAATGCGAATATAGGACTATCGTTGTAG
GCAACCGTGCACAACGACACGCCAATTTGACTTGATGTCGCTGACGATAGTGTGACGTTCACTGAACGATTTGTTCCACTGTAGGTTTCGTCAACAGGGA
TCTCGAGAGATATGAATGCATGGAACGCTGAGACATTGAAGGTAACTTGGCCTTTTAGCAATGAACGCAAACACAATCGTTGTCAGTGTAACTCACCGTA
CATGAGAACTACTGATAATGCAAGCTCACCTGAGTTGTTTCCATCAGTCGCTATAGCGCACACAGCTCCGATATCCGATGGACTGCACGACCAGTTGCGA
TCTCCCACGACTTGAAAGTCCACCGAGTCAGTATTAGATGTTCCATAGAGCCGACCAACCTCCAAACTGACCGAGGTTCCTTCGGAACCGCCNNNNNNNN
NNNNNNNNNACGCACAAAGCCGACTATGCCAGACTGGCCACTGTCAATAGAGTATGTCTCGTTGGTCCAGGAACTAGATCCGTAGGCTCCAACTGCACGC
GAAGCAACAGTGAAGTTCGTGTCGTTTTCCGTCGATGTCAGATCCGCGATACGCAAAGTGTCGGGACACACAACCGTGATACCCACTAGCGCACACTCGA
CGGTATCATGGTAAACTAGCACGCCTGCGGCAGCGCTCTCCACCAATACTTCGACTTGAACTGCACTTCCGCCAGCATCAGCGGGAGGTATCAATGTCAG
CTCGAGCTCTGAATCTGAAGCAAACGCCAGTTGCGTGCCAGCAGTGGATGGTATTCCGCTTAAGGTTGTGAACGGCCGGTTCACCACATCTCCACCGCCA
CTAGCGGCTTGGATACTCACCATATAGTTTGTGGAGGGCTGCAAATCGGAGAGATATAGTTGACAGCAACTAAACAACCCAGACTTGAGTTCTAGCTCCT
CGGAGCTGTACAGCTTGTAGATGAGCGATTTCGATCCTCCAGTGTCGCATGACATGTCCACAGGGACAATAGCGCTACTCGCTTGAGCCACTGGATCCGA
CATCGTGAGTAATTCAGGAGCACTCAAGTTCGTCGTTTGGAAAGTCGCCGCCGCTCGAGCAGACAATCCGTTAGTATTGCGAACCTCCAGGCTGTAAGTG
TATGCTGTGCTTGCTTGTAGATTGCAGTGAGTGAATGTTGTCCCGGATTTTGTGGCGTAGATACCCACCCCATTAGCACTGAGCGATATGAGCGACAAGG
GTACACCCCCAGTGTCCTGTTCTCGCAACATTTCCAAATCAGAAGGATGCCTTCAATCGCAGCGAAATGACACTCTTACCGCTGAAATGTTCCACCCAAG
TTCTATGGAGCCGCCTGATGCGCGGATCACATTTAACACTGCCGGCATTGGCGCCGTCGGTGCACTGCAAACCGATAGCATCAGTCGAAGTCGGATGCAC
AAGTCAGTCAGTTGAGGCCACATTAGAGTCGAGAACGGACACACAAGAGTTATCTCTCACGCACCTAGTCGTGACAAGTTTCCCATCAGAATACGTGCTG
TTGCCAATTTTGTTTTCCGTTTGGAGAGATACAACGTAGTCTGTGGACGCCTCCAACCCGTCAGCAACGCACGACCCTACCGAGCAATTCGACGAGCACT
GCACAAGGACTTCAACCAATATTCCGCAAGGCTTCGATGCTGTGTCTTGACAGTATGATGCCTCGTCGGTGCCAGTCGATACTTCGCACAGACTCGTCAA
AGCGTAGAACTCAAGATGCTGGGGCAACGACGATGAGTAATTTGCAGCGTGCGAACAAGTGGAGCATCCCGTCGATTTGTCGTAACAGCCCGCCAGCGAT
CGGCGCATCATTCGATACGCAACTGCGTCTCTCGGGACTCCGCCCGTGTCATTGGTCGCCGTGAACGATACATTGATCGACCCGCCAGACACGTTGGCCA
CGCCAATTGAGATCGGAGGAGACGGCAACCCCGGAGCCAAAGTTGTCGCAGAAACGGCAGTCTCGTCGACTGTGCCAGTTATGTTGTACTGGTTCCGCGC
AACAACGGAGAACACGTAGGTGTGCTCAGCAAGAAGACGGATCGCAGTGAAATTCGATTGGTTTCGATCGTCAATGTCAGCGACAATCTTGGCATCCTCA
GCTGTGGTGATATCGCGCTGATACACGACATACCCTGCAAGAAAAACGAGGAGCTGTTAGCTTGTCCAACTCGCGCTTTTATAATACCTTTGGCTTATCC
TTACCAGCGACTTGACCGCATCCTGTCTGTTCAGGCGGCTCCCACTGGAGGAGCACTGAACTCCACCCGACATCTGATATGCTCAACGACTTTACCTTGG
ACGGAGTACCCGCGTTGCCAGATCTGAAGGTGTATTCTGGGCTGGATTTCGAAAGGTTAAGATCGTTCACTGTTTGAGCAACAACAGCGAACTCGGTGTT
TGCCTCCAGATTATAGATCATAGCGATGTCTGACTCGTTTCCGATAAGAAACTGCGAGACTATCACGCCTTTCGCATCGGTAACTTGGCCAGAGTATCCA
AGAATTGCGGCACCACAGAAATCATTCGGCGGTGAGAGCACGACCATCACCGTGCATCCGCTCAACAGTCGAAGGCTGGATATTGATGGAGGATCTGGCA
CCGACGCCTTGTCGGTTTCCACCGAGAGAGCTTCACTCAACAGTTCAATATCCACTGCGTCGTCACATACCACGCCTGGCTGTAGCGCAAGAGCTTTGAA
CACGTAGCTCGTCTGCGACGTCAGGTGAGTGCCGTCCCAGTCCTGGACAATTGTTGCTATCACAGACCCCTCAGTGGCCTTCACAGTCTTCAGTCTGACA
AACGAATCGTTGTGCGCGATGAACACGTCGAAACTGGTCACCAACAAGCCACCTA