Description :
From Genome Similarity Track
Location :
Scaffold_1706:3178- 5349
Sequence
2171 bases(100 bases per row)
TAGCATCACAGCCATATCGCCTTCCAAGCGGCATGATTGCCTTTCATGCTGGGATCGGATAGTGTTCATTCGTAAAGTTGAGCGGACGGAGGCGTCCCCC
ACGGTCCACTATGGAGATTCGCGAGGGAGAGACGCCCAATTTTAATAGAGAAAAACGGTTCAGTGGCGTCTCTGCCGTCGTAATCAATTTTTAGTTTCTG
CCACTACGCTTGCTTTTTGCTTTTTATGGAACGTCATGTGGCAAAAATTACTTCTATTTTTTTTTACATACACGGTGGGTTCGATTTTCTACTGGAGCGC
AAAGGTCGATTTTATGCTTTTTACCGATCACATTTTGCGCGCGAATTACGGATGTAGGAGAGCTAATCTGCTTGGAATTAGGATACCGCAGCTGGTAATT
CGTAGGTATCCGCTTGTGTTGCGTTGCAACTGCAGTCTCTGCGATGGGTTACACACAGGCAGGTGGTTGCGGTTGTTGTTGTTGAAGCAAGCCACCCCAC
CCCATGCGTGCGGTCGATCCCAACCTGTAGGCTACAGGGNNNNNNNNNNNNNNNNNNNNNNATCGACCCGCACGCTATGGTACGGCGTAGCACAGCGTGC
GTGTGTCGTCCTTTTGGCAAAGATGCGTGTACTGCAAAACCACGACGACACGCACGTCCGTACAGTACTGAGTAGGCATGTAGGCAATCAGGCGGTGACG
CGCCTCGGCGAGCCAGTAGATGACGTCGTCGTCATGACTGTGCAAATATGCAAGTGTGCATTCTTTCTGTGAATCCGCGGCGTTTTCGCATATCCAAATA
GCTTTGTCACACCTCTGCGGAATATAAAATACGCATGCCGTTGTTTTCAGTACGAGTCAAAGCGTTGTACCGTTCGTTTACTTTTGGCATGCTCCAGTTT
ACCGCACAAACCTGCTCTCTCACTTGCTGCATTGCGTACACATTCTTCGATGCTCTTTCTGGTCGCTGCGAGCCAATCAGATGCGTCGGCAAGGGAATTG
CAGCATATCCAACGTGCCGAGCAGACGCATCCGTTGCAGCCGCGTCAAGTGTCTGTTGCAGGTCGGTCGGAGTGGCTTCAACTTGCGGACTCGACTAACT
GACTGGTTGGCTCTATAGTGAGGGTCATGTGGACAATTCCGCCTCGGATGACGGCGAAGAGACATGGAGAGTGGCAGATGTCCCACAGATACCCGTCAAC
AATATATTATATCCCACCCTATTCAACTCGGGTTTTTATAACCCATATCTTTTAGTAACCCACTGATCCTCTATTTCCATACATAAATTCAGTTTAATAC
AACCCACGGGTTGTTCTCTTGACCCGGTTTCTTTATTTTGTTTATTATTGTAATTTGCTGAGCTTAACACAAAACCACCCCTACCCCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATAGAAAAAGAAAAGCGCCCCAGAAACCAAGATCGCAAGATCGCAAGCCACATGCACCCCGTCTGCT
CCACAATCCAACGACAACCATACGCGCCACTCTCCATTATATTTTGTCTAATATGCTGTCCCCATACAAAAGCGCCACCCAACGCCGCCGNNNNNNNNNN
TCCCCCTCCTCCTCCTTTCTTCTCCCTGCGTACATATCGGAAGGCGCTGGCGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCTTTCGTACCCTCCAGGTAAGAAGCAACCAAATTCACACGCGTGAGT
GCGCACCACCCATCCGTTTGTAGCTTTTGGCGATCTTTTTGGGTGTGACGGTTTTACATACGAGTCTGACGGAAGATCGCTTAGCGCACGCACGGTGAAG
CAAGTGAACCGCGCGCGCCTCTTGACAAACAATCCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCCCACAGATCGCGTTGAGCGCGCAGGAGCTCAAGTACTACAAACGCCTGGGCAAGG