Description :
From Genome Similarity Track
Location :
scaffold_199:31764- 38896
Transcript NameFunction/comments
Pl_107836HECT E3 ubiquitin ligase, putative
Pl_107837hypothetical protein PHYSODRAFT_284636
Pl_107838hypothetical protein PHYSODRAFT_263945
Pl_107839hypothetical protein PHYSODRAFT_467118

Sequence
7132 bases(100 bases per row)
AGAATGTGGTTCTAGCCACACGTCGCGTGCTTGCATGGGTATGTGGGTCCTCCACCGTCTCCTCCATCGTAGAGAACTCGGCCGAAGTGCCACACAACAG
ACACAACTCGTGGTTCGGATGGTTCATGTGCGCACAGACTAGACATTGCCATTCACTGCGTCCTGCGTCCAGTACCGTGTCTACCAGGTCCTCACGTAGC
TGTAGAGTGCGTAGATCCACCGAGTCAATGGCCACGTCGTCGTCCAGACGGTGGCAGTAGCTGGCGCACAGTACAATGACACAGAACAGCAGCAAGACGC
ACACCCCCGAGGCGATCAACGCCCCGCCTAGAGACGACGAATCACTCATGAATCAACGCTTGTTCCTGCGGCTAGTGGCTTGAGTAATGGCTGCGGTGCT
GGCAGGATACTTGTACCTATCGACGCTACCGGATACACTGGCACCTACTCAACCGCCGTAGAACTCAGTTACGCAGTGGAAGTCCGGAATTACACTGACG
TTGGATTGCAAAATTTTCAGCCAATGGGAATGTGACGTTGTACTCGAAGTTTGTATTGACGCTGAGCGATGTTGTTGTGTGGATGAATTGGTGCTGAGGT
TCTACTAGAAGTTAGGAATTAGACACGGTTGGGATCACCAAAGGTGCTTGGAAACAAGAGTTGTGTGACAAGCGCACCGATATTGAATGCAGTTTTCGAC
TAAGATTCAAGGTGTCGCTACATCGCGAGAATCCTGTGGACCTCGAAAATGAAACTTCTGTGATGAAGGCATGGAGCTTAGCCACATGTAGCGCTAGCAT
GACCAACATGACCACGTGACATTGATATTCAGCAGCAGTAGCGCAGAACTTTCAACCGCCGTGAACAGCGTGCGAGGTAGCGTTGACAACGAGACACTCG
CGTGTTGTTGATTGTTTGCCAGGTGCCCAGCAAGAAATTGTGCAAGCAGGCGCTTTGGAAAGCCGTGGTCTCGCAGTCTAGCACACACGAAGGCGTTTGT
AGAACGTTTTATTTATTCGGCGGTAACGGCGATCGTAGTTGTAGTGGTTGTGTCACTTCTAGCGTCAAACACGCGCGTTGGACTGGCAAGGTCTCCCGTT
ACCCGGACTTTATCGGCAGGTTTACATACATCCTAACGCTTTTGCTACTGATAATGCATGCGACCTCCAATTCCGTTGAAAATGCGTTGCTCTAGCTAGA
TGAAGTAGTGGATTAGTGCATGAGGCATGAATGAACGAAACGACTTGGTGTACACACTACAAGCGATACTGAGTACAAGGCAGATGATGAACAGCGGCGA
GTGCGATATCAGCACCGGACAGGCACGTCGGAATAAACACAACTTGTCCAACGAAGTTCGTCGGCTGTTTCGTCTACAGAAGATGGCTGTCAGGGCTGGT
TGCAAGAGCTACTGTAGGACGCGACGCAGAGAATTCGCCGGCCAGTACTCAGAGCAACAATGAGACTGAGAAGGACTGCCTAAATGATTACTGGTGATAA
GGGATCTTTAGAGCACGAGTAGTGTCTGACGACTCGAAATGAGCCTTTTGCATCGCATCCAGCATCATTGACAGCTTGTGGGATTACGTTTTGAACTCTA
AATGTACACTCGAGACAACGAGAGGGCTTGTAGTATGCTTGATACAACAGCAAGCACATGCATCGACGCAAAATAAAGCGTCACACATCATTGCCCGCAT
TTCTTGGATTGTGTGCGGGCACGTGTCTCGGGCTAACAGCCGAGTTGCATCAGGTCCGGCAGCTAATGGTACCTCGAGTGCTCTGTGACCACCCATCAAC
GCAATATGAAGTTGCAATCCGCCAGCGCACGAAACGCATTCTCCTGACTGCGGCCCTGTTCATGTTTTCGCCAAGAGAAACCCTCGCGTCCAACCGAAGG
AAGGCACAATTACACTTGCTGGACGGATTGAACTGCTTCGCTGACCTTTGTCATGTGGGCTTCACAAGTGCTCAAGCTCGCAATGAAAACGTCATGACGC
TGCTAGTCTTTTGTAGTGTTCATAAGGTGGATCAAGTAAGTGTCGTAGATAGACCCCTCTGGGAAGCACAACTACATTGCCTCGACGAGTAACGAGCCCA
CTCCAACGCTCTAAGACTACAGACAGAAGTAGCGGCATTTTTTCCATGGTTTAGACCACCAACCAGGAATCAGCTTTGCCTTATGATGTACGTGAACCCC
GCGATGGCCTAGCCAGCTAAGCAACAATATACACGTCTAGTTCCGCCATGATGAAGAAAGAGAGCGCAGCAGTGCCAACACAAGAAGCTTCCGGTAAACG
GGAGCTGTCTGATTGGCCAAACCTGCATTTCCACCAATCGCAGCCCGGAATTCCGTCCCCTGTCATAATCCATGCGATTAGATACCGCAATGTCTGCGAT
TTGATTGGGGGCAGGCACGCGCCTCTCTCGTAGCTGGAGTGGCACACACGAATCCGTTCGGCTTGGCATGACAGGTCGCCGCTCATTTCGCAACGGAATC
TCCTCGACACAAGCTCGCAAGGATAATGATCGCTCGCTCGGCTCTCAAGCGCTCTCTTGGCGCGTTCTCGGCCTCCCGCTCGGCTGTCAGCGTGGCCCCT
GCCTTCGGCCAGGTGCGCATGTACCACGAGAACGTCATTGACCACTACGAGAACCCGCGCAACGTGGGTGCGATGGACAAGAACGCCAAGGACGTGGGCA
CGGGTCTCGTGGGCGCCCCCGCTTGCGGTGACGTGATGAAGCTGCAGATCCAGGTGGACGAGAACGGTACGATCGTGGACTCCAAGTTCAAGACGTTTGG
CTGCGGCTCAGCCATTGCGTCCTCGTCGGTCGCTACGGAGTGGTTGAAGGGCAAGAGCGTGGAAGAGTGTCTGAAGATCAAGAACACTGACATCGCTTCG
CATCTGAAGCTCCCGCCTGTCAAGCTGCACTGCAGCATGTTGGCGGAAGACGCTATCAAGGCCGCCATCTCGGACTACAAGAAGAAGCAGGCCGCGTCGG
GCTAATATGGCAGAAGAAGCAACAGTCTTGTCGTCGCCGCGCTTGCTTCCTAGTTCTCAGAAAGGCAGAAGATCAAGTGGAGTAGTCGGCGCTGGGTGCG
GGCGGAGCTTGGCTCGCACTTCGGGGTAGACAGGTCAAAGAAAAGCATACAGTATTGGAGGAGAGAGTGAAAGCTGTGAAATAATCAGTTGCTAATTTAT
TGCCATCATCCTATCATTTCTTGTTGCCTTCGTGCGCAGTGTCGTCATACAGTCTTGTGGACTCGATCGTTTCACGAGTTGATCACCACTAACAAGACTG
TACGGCACACGGCGTGAGATGCCAGTCGTCAGTCACCAGTAAAGAAGATGCACAAGCAAGTTGAAGTCGAGCTGCCTTTGGGCAACGGCGCTCGCGTCCC
TATTTACCTTTCTCATAGTTATCTTTTATAACGTAGTCTAAACCAACTAATAACTAATAGTCAGTCTTCATTTATCCAAACCAACTAATAGTCAACTAAT
AGTCAGTCTTCATTTATCCTCGGAACTGGCAGATCCCTCTGCAAGCCACGGACTACCAGAACTCTTCGTAGACCCCTCTGCGAGCCAAGGGTTGTCACCA
CCCATACAAGGTAGAAAGTGTCGCGGAAGATAAGCGTCAGCCACCGCCACTGGAGAAACTCGCATGAATGTAAGATAGTCGTAAACATTGCTCCTGCATG
GATCGATGCACAGACCTTAAGCACTTGAAATGCCGATAGCAGCGAGAACGATGCATTATTATTAATACTTGACGTGTTTGCTTCAAGGCTGCAGACAGTG
GTGGGCTTGTGAGCTCAACATTGGATTGCTCCATATCAACCATAAAATTAGACAAAACGCTGTGTTTTAGTTAATTCGTCGCTTAGTACGAGTTCACGAA
GTACAGAACCCGAATATCCCGTGGCGCAGTCACATCGACAACGCTACGCTGCGCTGCTCAGGTTGTTTGATCAGTTCCAGAATTCGGTCGGGCGTAGGAA
GACTTCCGGCCAGTGACTTGTGACTGGAGGTACGTCACGTCAACCCCACTCCGTTTCACTGCGCTGGACTCACCACCGTATTCTTAGGTCTCTACATGCC
AAACCACCGCGCAGGCACCACCAGGAAACGTCCGAAAGCTTCTCGGCCGCGTCGCGAAAAGCCTCGAGGCACGTCAACACAGACGCAGCTCGCTATGGCT
ACCACCGAGTCCCTGCGCACCGGTGTGCGCTCCGTGTACTTGCCACAGCACATCGTAGTGCTCGTCCATGGCAATAACGGCTCAGCCGCAGACTTTGACG
CTGTGGAAACGGCCTTATTATCCAAGTACGGTGAGCGCCAAATGCTCATTATCAAGTCTCGAGCCAATGAACCAGACACGTCGTTGGGTGTGGAGATTGG
CGGTACGAGACTCGCTAAGGAGGTTGTGGAGGCCGTGTTTGAGTACGATCTGAGCCCTGCAGTGACCAGCTACAAGTTGTCGATGATCGGACATTCATTG
GGTGGCCTCTATGCGAGATATGCACTCGTCCAGATCATGGATTCGCTGAGCTGTTTGCACGTGGAATACGTGGACTTCGTGACAATCTGCACGCCTCACT
TAGGCTCGAGACGAGCGAGAGGACCATCGACTGTGAAGGTTCGTGGTGTTGTTGTTGTTGCAGTTGATTGCTGTATTTATTAAACGGATGTTGATGCTGG
TGTCGATACAGAACATCCTTCGTCTTGGAGTGCACAAAGTGTTGGCGTCGCGGTCGATATACGGACAAACGGGCATTGATCTTCTGCTTGATGGTGAGTT
GTCTTATCGCGATGGTGCATGTTGTCGATCGGTACTGACCGATGCATTGTGGAATATACTGTATCACATAGCACAAGAACAGCAACAGGAGGGAGTAACA
GATGCACATGAGGTCGAACCGCCTCGTCCGCTACTTGAAGTTATGAGCGACCCTGACTCGGAATTTGTCCGCTCTCTCAAGCGCTTTCATCACGGTACAT
TGGTAGCTATGACGGATGGTGATGTGGTTGTACCGTATCCTTCGGCTTCCATGCGCAGTTATAGCCCATACGTGAGTACCTTCTTGACAGAGCGTTATAT
GGATTGGCGATGGCATATTCGCCACTCAGGATTCGCTGATGTTGGTGGTGACAGTCGTATGCACTCGGCGTATGCAGCATTTTTAGAGCGACTCAACTCG
AAGATTGATACTTCGATTGAAGTCGAAAAGCACGAACTGGGGCTTGACGCAAGCTATGCTCCAAGATATCCCAGTATTGAACGGTTTGACTGCGACAACA
AGCAGGAGGTGGAGTTTCCCTTCGAGATGCTGTGTCATCTGCAGCAGGTGCTTCCATGGCGACGCATTGACGTGACAGTGGAGCCCTGCGGTATGAAAGG
CAAAATGCGTCTCCATGACTGGCCGATCAGCAAGATGCAGCCTCCTGACTGCCGTGCGGACGAGTTCATCGACCTCTTGTGCGATATGATCGGAGCCGAT
CACAAGATGCGTCCACTGATGACACCGGATACAGTTGGCAGACTGCATGAAAGTCCAGCGCTCGCATTAGCACGCCGACTTAAAATTGCAGTAAAACGAG
CCGGTGACAATGCTGCGAGTGATCAAGGAAGTGTTGATAGTGATGCTGAAGCACAGCACTCGGGGATGACTTCTCCGACCTCAGCTTCCTCCGTAGCATC
GAGCGATGTCAATACCGAGCATTATCCAGTCCGTGTGTAGATGCATGTAAAAAACGCGTAATGTATTGGTACAAACTTTGTTCGAAGAGCATTTTTGAAG
GTTCACATTGACGTCCTCAACGCCTTCACTACGTTCAACAACACGTGAAAGTTGCTTCTTTCATTCAAATTCCCTCAAGCTGCGTTGGTACCAGCAATTC
CTCGTCCACCTTGTAACTTCTGCTGCCAGGTCACACGATCTTCCGATGACAGCTCAAATCCTTGTTTCAAGCATTTACCGCTTGCCACTTCGCACGCAGT
CTTCAGCACAGTTTCCAGTGGCTCCCTTCCACATGATAACCCTGTGAGGCTAGCTCCAATAAAAGAATCACCTGCCCCAATCGTCTCAACCAATTTGCCA
ACGCGTGAAGTTGGTATGTGATGCATAGTCGAACCCAACACATCCAGGTAATAGACACCTTCGGATCCCCAAGGACAAATAAAGGCTTTTGCTTGGCTTG
TCAACTCGTTGCCCCATTGTTTAGTCCCTATAGCTTCGAAGAACTGTTCTGCGCTTTGAAATCCAAGCTTTTCGCGGATATAGTCCTTGGACAAGAAGGC
GTAATCCGCCAACGATATAAGCCTGAACAAATTTCAGTACATGATAAATCTGTGAGATCGCTGATGTCAACATAAGGTTTCCACGTTGACTAACTTACTT
CATTGCAGGTCCCCACTCGTTGCGCAATGCTTCAATCTCAACGGAGATTTTGGCAGCAAACAGTTTTTCGCGCACGTGTAGCATCATCTGCTCAGTTGCA
TCCAAGTTTCTGCCCTCGAAATGAAGCCACACCGGTTTGTTCACGTCATTTCGTTTTTCTTCACGATACACAGCGAGTTGCTTCACAAACTTGTCATAAC
TCAGCTCAGCAAGATTTCGCGAGTGCACGATGGTGCGTGACCCCGTTTCGCGGCTAGAAAGAATGTACTGATAGCCACAAAGGTCCTAGCGTAAGAACAC
AGTTATGATATTTCCTCATGCTTTTGCCAGACTCACCGAAACTGGCATATTCCCTTCGCCCTCAATGCTCGCAAGCGAACAATTAACACCGAAGGATGAA
AGATCCTCGTGGACAAACGCTGCATCATTGTCCTTTGTCGGGTCCGTCGATACACCCAGCCAACGGCACCGTCCTCCTAGCTGAGCACACACAACCAGCG
CGTTCGCAACGTTCCCCCCTCTGCATTTGCGAGTCGCCAATGACCGAATCTACGCAGTACCAGGAGCATGATGCAGCAATGGTAATTTAATGTAACAAGA
GCAAATCTCCCACTTGCGAACCTTCGAGTCCTCTGTTCTTCACAACCAACAAACAACGTTAGCTGCTGGTCTTGTACGATAGCCACACGGTTTCGCAATT
ACGAATAACCTTGAGGATACGTTGCCACCTCG