Description :
From Genome Similarity Track
Location :
Scaffold_175:31760- 39929
Transcript NameFunction/comments
Phyke_g5866hypothetical protein
Phyke_g5867hypothetical protein PHYSODRAFT_250872
Phyke_g5868hypothetical protein PHYSODRAFT_515430
Phyke_g5869hypothetical protein PHYSODRAFT_303721
Phyke_g5870hypothetical protein PHYSODRAFT_303722

Sequence
8169 bases(100 bases per row)
GACGATTTTTCCAACCGCATGGACTTGGTACTGACATTCTTTCGATGCAATGAGGGTCGTTTAATTCACGGTTGTAGATCTCATTgtgtttgtttgtttg
aaGATCTCCAAGGCTATGGAGGACATTAAGAATGGCACTTTCGACCCACTCAAGTGCAATGTAAGCTCCGTTAAATAGGCATCAGTTGGCCACTAAAAGA
GCTAATGACGTTGCATATGTGCTGCAGATTCCTGGGTACAAAACGTTGGAGCAAGAGGAACAGGAGCGGAAGGAGCGAGTcaagcgtgaagaagaacgtc
gAAAACGGGAGGACGAACACAAGTGTAGGGAGAAACAAGAGGAGCATGATACCTGGTGGAACAAGGCAGAGCTACGCTTCTCACTGAGAGATGCAGAGGG
CACTGAGGAAGATGACAAGGACATCAGCAAGAGCGCGCGGTGGGCGAATCGAATCCTCGCCGCCTATAAGGCACGTGACGCCAACGACTACTCGCTATGG
GACCAGTGGGTACCGGAAGACCCAGTCTCGCTGCAGGAAAAGGCAGAGCGcgaggcggagctggagaaactgcGCAATCGCGAGTTCGAAAACAACAACC
CTGACTTCTGCAACCAATTCAAAGAGGACATGGAGAAACGGCAGCACTCccaggaggagaaggagcgcaCTGCTGAGCGTAAGAgttgaagaagtggacg
tAAAGATATCCACGGTCTATTGCGATTCCTGATGTGTCAAACTGACGCCTGTGCTATTTGCTTGCGTTCAGGTTTGAAACAGAAGGGCAATCGATgctac
aagaagaagcagtacGAGGATGCCATCAAATCCTATATGCAGGCGTTATCGGCCTCGCCATTTAACGTAGCGGTTCTTGCCAATATCGCGCAGTGCTATC
TGCGACTCGACGAGTTGAGCGACTGCATCGAGTTTTGCACCCGTACACTGTACATCGACGCGGACTATGTGAAGGCGCTATCTCGTCGCGCAACAGCATT
TCATCAGCAAAAAAGACTCAAGGAAGCAGCCGACGACATGCGAAAAGCTTTTGCGCTAGATAAAGAGAATGTCGATATCGTGGAGCAGCACTCCATTATC
GTTGGCGACTACGAGGACTCAGTCACCAACAGCGAGATCgaagcagctctgcaacTGAAAagtacaaacagcaaaaacaagGGTGATGGCTCCGGCGCCC
TTCCATTCAGTACATCATCCGTCGAAGAACTTCGATTTTCTCTagagctgctcaagaaaaTGGACGAGCAATCAATCGTAAATAACCCGAAAACGGAGGA
TCAACATGGTCAAGTGCTGGACGCCTGGGTTGCGTATGATCTCTTGCTACCCTTCATGGAGAGAAATGAGTATGTTCGGGCGAAATTCCGAACGTCTGGT
GAAATGAACAAGCTCTGCGATCGTTTATCGGCTGTGTTGGAGGAAGTAACTTCACCAAATCCCACATTAGAGGTTGGCAATTCCTGTcgtcaagatgaag
gtgtCATCGTAAGCGCCATGATCAATTGCgcggcagctgcagtagCCAACACACCGCGTAACCAAGTGGTCATGTTCAGGCACGCAGCTTTTCGAAAACA
AATATTAGCAGCTCTTCGTCCGCTGAGCACGCAATTGACTGAGAAAGCACTTTGCTCTTCATGGATCGTCCAAGAAAGCCTTGTACGCCTCCTAGAGCAG
GTGCTTGACTCCAAAAGCTGGCGAAATGCTGTAATTGCATCAGAGGATGTTATCACATCTCTTTTCATGGCTCTTTGCTTTCGAGTCGATGACAACAAAG
TGTCAACTGTGGAACGTGCTTCCAAGACTGCAATTACTCTCCTAGCATCGAGCATATGCTTCACTCTAAGCAATGAAAGTGCTGGTATTCAGGCGTTTAG
TGCTCGCGGCGTCGACTGTCTAACCTCTATCGCTCAAGCACTTCAGACACATTGCAGTGGTAAGCCAACTGCTTCGTTGCACAATTTACTGGGTTTCCTG
ATTAATTTGTCGACCGACACACTCATTCGCAAGACGATGGGGAGCAATACTTGTGAGGAATCTCGCTGGAAGATCGTGCAGGCGTTGCTCCAAATCACTC
AAGAAACATATTGTGGGACTCCATCAGCATCCACAACTCCAAGGGACTTTGAAAGTTCGGAACGTGCCCTTGGTGCGTTGTTGAATCTGTCATTTACGGA
GAGCTTTCCTGTGCATGTACACGACCTGCTCGAATTCGGGGCAGTGGACACCATTGAGAGTATTCTTGCACAAGCGAATCTGTCAAATTTTTCAGAATCG
GTGCTCATTTTGTCCCGATCGGCAAGCCTACTATGTCGCCTGCACTCTGTCTGCAGAGCCGAGAACACCGCCAAAGGATCAGTAATGGATCAACTCAGCT
CTCCTAGACTGCTATCGAAACTATATGCGGTGTGTGAATACGCAAACTCTAGTGTCTGCAGTAAAAGGGCTGCAATATCAGCCGAGCTATGGCAGGTCTG
TGCGCAAATCTGGTGCCACTTTGGTTGGTGCGCGCACCTTACGCACGTCCGAGCGTTCTTGCGCGAGAAGCAAGCTGTGCCGCTGCTGATCCAAGTGATT
ACACTTGCAAATGCTCAGAAAGCCTACAGTCGACCTAGCGGTGAGACGACCCCATGCGAACGACTCGTAGGAAATATCGTGAAGGTGCTGATTGCCGTGC
AATCTGACCACGACTCGGCTGATGCACTGGTCTTCCGGAAGAAAGCGAGTATCAATGTGTTGGTGAAGGCACTCGAAAACCTGTCTGACGGGTTAGCGCG
AAAAAATATTGCCATCTTGCTAGCCAAACTATGCCAGTCTGATTCGGAGGTGAAGGACTTGGTTCGCGATCTGCGTGGAATCGAGATGATGTTGTCAATT
AGCCAGTCGCTCAAAACGCCTGTCTAGGTAGATACCAATTACTGCGCTGTGGGGAAGGAATTTCATTCATAGCAAATCGACACTTTTTCGATCCTCTTTG
TTGCTGCGTAAATGTCTTCAGATATGTTTGCTGAATCACAACAGATGTGCTTCGACTCCTacagcgatgcagcagctacgtATGGAATGAATACACCATA
ACATCCACACCCACACCACCACAATTTAGTTTTCCCATCGTTTTGAACACATAGCCCACGATTCCAGTGAGATTTTTACCTGACGAACAGTGAGAACGGA
CGCATGTAGGAAATGACATATTTCTGCATGCCGGTGTCCTGCGTAACCAAAGAACGGCAATGAATCAATTAGCTAGACATGTAGTGAGCGAACTTCCATG
TTAGATGGACTTACGCCTTCTTTCTCAATCTTGAAGAGTGTGTAGTTGGTCTTCGAACAACGGATATCTGCCATGGGATTGATGAATTTCTGTAAACCAA
GTGTAGAGGTGTACGAGTTTGCTTAGTAGTTTGCGTTTTCGTTTGACCATGCTAGTTGGCCGTCTCCAACGCACCTGGATGTTAGAGCAGTAGACCTCTG
TGTTGTCAGCCGAGGCTGAGCGAGCTCGGGTACGGAAGAGGTTGAATCGATTGGACTGAACACGGTCACGATAGCCGAGCCGTAAGCAAGCACACGTCAA
ACCTGAAACCCCGAATGCTTGTACCTGAGATCGGAGGCGAACCGTGAGTTCTTGCTTCCTCGCCTCTTGTTTGATGTCAAAATGCACTCGTCCAGATGGC
TTTGTGGCCAAAAGTTTAAAGCACTTCGTATCTGCCGATGGTGCCATCAGAACCTTGCCGACGTAACACGAGTCCGTCCAACTGGTCGTGAAAGTCTCGT
CCAGGCTGTCATGCATCTTAGGGCACTCAGCATCACAGCAGCACTACATGTACCCAAATTTCCATACCTGAAGCGAAACTTAAACTTGCCGGTGCGCTTG
CGAGCAAAGAGGCAAAAATCGTTCTGGCTGTCGTGAACTTGGGGGATGCAGATACGGAAGAATTTCGTCCCATAGCGAGGAACCTACAGGAACCAACCTC
CATCATCAGTAACAAGGGCAGCCACCCTGCCAACTTTAAAAGCTCAGGTTACCTCTTCACCAGTAGCCAGCTCCATGACAAGAATCGAGAATGCAGGAGG
CGTGTAGTGCAAAAATGCCATGGGGCCAGTGACGCTGTCGCACTCGTCATTCTCCTAATCTCCGGCAACATAAATGACAGAATACGTCAAATGAATCCCC
ATCCATGCATATTGACCACCTTCTTTCACCTCTTCCTCGATTGTCTTGGAGTCAGGAGGACTCATTTTCACCACGGGTGGTATTGGGCTACTCATTGACC
TCGCCGACCTCGCAccagcggcagtggcagcCAAAGATGCAGGAGGGACGGTTGCAACTCTTGTACCGTCATGCTTGGCCCCTTCACTGCTTTCCACTGG
GACCACTGAGTGTTCGTCGTTGCGTGGATCATTCACGAACCAATCTTGACactcgtcactgtcactggCATCTGAATCACGGTCCTCGAACTCTTGCTTC
AGTCTGCAGACAAACCCTTTTGTGATTAGTTCTCGCCCTCGTACGGCACTAAACCGCTAGTAATCCCTTGTCCCTGAGCACTCTCACCGATTGGCAAAGT
CGCCCATGGCACTTTCCTCCATCATATTGGCTTGCTACTATCCCTGCGTCGAAGCACCAAACACGAGATGGTTCTGGGCGTAACGGGTCAAGCTGAATAA
CGTCTCAGTCTCTCGACGGGCGAGTCCACAATAGTCATTCGTGGCATCAAAATTCATGGTTGAAACAGTCTCTTGAAACCGAGTTGACACCTTTCATTAT
TGCCACAAGTTCCCTCGCAATGCTGGGCGAGTCTCGTTATCTCATACGAACTCTGTAGATGATGTGCATTCACTGCTGAATTGCCACGTGACGGTCACAC
CACGTAGATCAGTCATGACATATCGTCATTGTGGTGATCTTATCCTGCACGAGGGCTAAATATGCCACTTGTCCGCTATAAATATTGACGCATAGCCCAC
TCtcagctacatgtagctgtgCGTTGAGGGTGCGGCTGACACATCGCCCCAGTTCATTGCAATGTCTCCAACCGCAGTGCCCGAGACGCACTATGAACTG
ATTCGAGATGCAATTTTCGATAACGATCGTGCTCGAGTGGCCGAACTCTTGGTGATACCCGGTGTGGATGTGGACCATTTCGATGCTGGCGGTCAAACGA
TGCTGCACCTCGCGTGCTTCTGGGGTCGGATGGATCTGGCCAAAGTGCTGCTAGCTGCAGGAGCGAGTCTCAAGACcaaaaatgctgctggctgcacgGC
ACTTGATCTCGCGACACACTGGGGCCATTCCGCAGTGGCGGAGGTCATTCGGTTGcgtggaggcagcagtgtCTGGGAAGACAAGCTTGGAGCGATGCAA
GTAGAGCTGGAAGACCTCACACTACGAGCCGAGTacgtggagaagcagaacaGCGAGAAACAGCGTCAACTGGATGAAATGACGAAAGAACTGCACGCTG
TGCAGACTCAACTTGCTGAAGAGAGAAGTGCACACGCACTGACGATGAATACGCTGCAGTGTGCCCGTCAAAAGCACACGAACCAGAGAGAATTAAATCA
GCAGCTAATGCACGAGAGAGAGAGCCTTGTAGAGAAGCTGAAGGCATCGATGGTGGCGCTGGCCAATTCTGAGAAAGCGAACGAGAGGGCAAAGGAAGGA
ATGACAGCACTGAAAGCACACCGCGATGACATTTTGGGGCAGATGCAAGAAAGTGTCAAGaaacaggaggaggctgcacaCAATTGGCAACGTGccgagg
cagcagcagctatgGCAGATTCGCAGCGCAACTTTGCATTCTCGGAGCGCGACCAACTCTATCGTGCACAGAAGGCCACATTGTCCGATCTACTCGTGAC
CACCGAGCGCCTTGGAGCGGCTGAACAGGAGCTGATGACCCTCAAGACTGACTTGGCCGAACACATCTTCGAGATGAAACGGGGGCAGCGTAGTCAAAAG
CACGCAGCCCGCGCCATTGCTTCAGTTCCCACAGATAAACTCATGCAAGGCAGCCGTCGACCAACCACTACACCTGCCCTAACGCTGTCAAGTAGTGAAA
GACCAGCACAGAAGCCAGAGGAAGTGCAGCAGATACTTCAGATAGCAAAATCGACGCCCAAGAAAATGTTTTCACTCGCAGCACGTGAATATGGAGATCG
TATACGTGGTGAGGAGCAAAAAAAGCTTCGTGATCGTTtacagcgccagcaacaagtggaGAATCAATATCGTGCTCATGGCTttcgagctgctgtggtg
gatgCCGAGGTTTTCCAGGAAGAGTTTGTGTCTACTCTGCGCGCTTTCGCGTCTTCGCGGAGTGAAAAATGGCAAAATCTTAAGCGCGACAGAGATCGAC
AGACACGTTTTGCCGCCAACACGCTTGCTCGACCTATTTCCACGGCACCACAGCAGGACCAACAGCATGACCCAGCATTCGGTTTGGGCAGCACGCTCAA
CTACAGTCTCTACAAGAAGTATTCTTTGCCATTGTCTCCGACAAATACTACAGCGGGGCTGAGGCCTGCGACATCATGCATGGAGCTACGAATACACGCT
GACTTCTTGTCTGAAGCTAGCAAAAAAGCAGCAGTACTCCAACCAGAAGTAATCAACACAGACGGAGAGAAACCAGGGGTGATTTTACCCATGGTCCGAG
TCAAAGATCATAACGTACGCTGCTGAGTAAAAGTAGCCAAAGGAATATTTCTACAACTGCGTTGATCGGGCCCAGAAGAGTTTGTTGGATGCTGGTGGGG
ACTTCTTGTCGCTGATTCCAACGGAGTCACTTCGccttggagcagcagatgtAGGTCGCTCTAGATGATGCCGTGACTTTACTGGTGGTGTTTGCCGCTG
TTTTGTGGTGGGCAACGTCGTTTGTACTGGTAGACTTGCTCGTCGAGGAGTTTGGCTAATTGGGGAGCCTGCGGGTTTCTGTGGCGTTGCAGCAGGAGAT
TTGTGGACAATCGTGGATCCTGACAGCGGATCGAACCTCTCTAGCGATGGTTGCTGGCGTTTTGAGTTTACGGCGTTGGCAGTCGCACCCCTGGACGCCT
CCAATACCTGGACTACCTGGACGTGGTTGAGATGCACCATTGCGGCAAGTTGTCTGGTCTCCTTTTCGTTCATTGCGCGCGTCAATGCTAATGCCTTTTG
TGATTCGGCAAGCTGCGATTTCGTTGTCTCCAACTCTCTTCGATGCTTCACGCGCTCCACCGCAGCACTTTCTAATTCAGCAGATAGCTCACGCTGCCTG
AGCACAAGATGCTGCACCCTGATGCGCAGTTTGTTACACACAAtggcgtctccacctccattAGGGGCattctccagttcttccagccGATCTTCGAGTG
CCTTATTGGTGTTTTGCAGCTCCTGACACGAGATGGTGATACGTTTTTTCTCCTCTTCGAGGGACGCCACTACCTCGTTGTGAACCAAgcgctgctcttc
cagcttgaATATCACGAATCTGTGCACCAGCTCCGCGAGGTCGTCTGCAAAGGCACATAGATGGAAAATCAATTTTTGCTGCGTTTGCTGAAAGAAGGAC
TGTGTCAATGCAAAGAGTTCTCTGGCCCCTTTTTCATGATTCTCCATTGCCTCAATGTGGTTGTCCGTGGATTGAACGTTTGCTCTGTCCAGCGTTTCGA
GGGTGTGATGTAAGGAGCGTTCCTTCCAAAGCTGCACATTTGAGTAGAATTCCCGCAGAGGTTGAGGTCTTGCTGCATTGGACGTTGAAAACAACTTGTT
AGCACGACAATCTTCGATATCACTATAGAGCTCGCCACACTGCTGTTTGAGCTTGTCGAGCCGCGAGCGGATCGTCAAATGCAGCATTGGGGTTGCATAG
GTGCCTGAGCTCACCATCCGTGCCGAAGTTGGGTTGGGTGAAGCGGATGAATGCACTTGGTGGGACGAAACAGCATCGCATGAACGCACGAGTTCACATA
TTTTTAGTGGCCAACAACGCCTTCAATTGCTCGTCAAATGGTTAACGCTTTTCTATCGAGGCCTTTGCTGTACACGGTTGAGCTTGTTTACTGCTCTTGA
TCATGCGCCCGgctggttcttcttcatcagccGAGACTCTGTTGCCACCAACGCTGGTGCCAGTGAGTG