Description :
From Genome Similarity Track
Location :
scaffold_27:3176- 5075
Transcript NameFunction/comments
g1345.t1 hypothetical protein PHYSODRAFT_323450

Sequence
1899 bases(100 bases per row)
TAGTCCAGAACGCCGCGAGCATGAATCATGCCCTGATCGTAATACCAACCAGAGTCAGGAAATCCGTCCGACATCGCTGCCAGCTCCTCTTTCTGGTGCT
GAGGTGTGTGGAAAATTAAGCGGAAAAATTCAGCCATGCTTTTTTATCTCATCATTAACATTTTTCAGGCCACTCAAGCGTTGTTGAAAGCTAAAATCCG
TGAAATTCAGTCGAGTCCGGTGCTGACACCGAAGCAAAAAGCTGAGTCAGTGCAGAATCTCATGATGAAAGACTGGAACGATGCCAAATCGAAAGCAGGT
GCTGCCAAAATCGAATGTGATAAAGAGGCCGAGCGCAAACAGACTTCATATCACGTGCGTCAAGGAAAATAAATAGTGTAGGGGCTTCTTTCACTCTAAA
TGATTTAGCTGACCTTGATTTCGTGCATGTACAGGATGAAGCTAAAACGATTTTGGGGTGCAGTCACTACCAGTACGCAGTCGCTTGTCTTTGCCCTTTT
AAAAGTTCTAGGCTAACTTTCTTGCCAATGGCGTCATTTTCAGGCGTAAATGCAAGTTGCTCGGCAAATGCTGTGGGAAATGGTATTGCTGCCGCTTTTG
TCATGGTGAGTCATCAACGACTTCTTGGCTGCCGAGCCAATTTCTAACTGACTTTGGTTTACAGATGACAGCGAGGACCACGCCTTTGATCGCTACGCGG
TAGATACAGTATCGTGCATGAAGTGCGACACAGTCCAACCGATCGGACAAATTTGCATGAACGAAGACTGCAAATGCGAATTCGGCCGCTACTATTGCGA
GGTGTGCAAGTTCCTCGATGACGACAAAAATAAGGACATCTACCATTGCGACAAGTGCAAGATCTGCCGCATCGGCAAGGGGCTGGACATCGACTACTTC
CACTGCGACCGGTGCAACGCCTGCATGAGCATCACTTTGAAGAAACACAAGTGCGTCGAGCGATCACTCGAGTCTGACTGTCCGATCTGCCACGCGTACA
TGTTCACATCGACAACGCCTGTCATGTTCCTTCCTTGCGGACACTGTATGCACGTGTCTTGCTACGAGGAGTACACCCTCGTACGTGAATGTCGTCTCTG
TGCGTTAGCTATTTGCTGATTAACAATTCTTGTTGTGCTTTTTGGCAGACAAACTATATCTGTCCGCTTTGCTCGAAGTCTCTGGGTGACATGGAGCTGT
ACTTTGCAAGCATCGACGAGCTCCTAGAGCGTGAACGAATGCCAGCCGAGTACGACGACTACAAGTCGTTGATCTACTGCAGCGACTGCGAACGCAAGTC
AACAACCAAGTTCCACTTCGTCTATCACAAGGTGCGAACAATGTTGCTATCTTTTCGAGATTATTTCGAGAGCTCATGCGTCTTGTTTTGGACTATGCAG
TGCCAATACGAAGATTGTATGTCGTACAACACCAAGCTCTTAAGACAGTTCAAGGACTCAGATGGACAGGTAGCGTGTGGGCCCGTAAGTCAGACGCATT
CACTCTAGAATTTCAAGCAAGAAAGTCCGGTAACCGCATAACAGGAATGAATCTACCTAAAAGCTACCAATATTTTTATTGATATGTACGACCCAGTTCT
TGAGGAGTTTGACGAATGGACAAGTCGTCGTCCTCTACACACATAGAGTCATTGAGATTCACTCTAGCGCCCGTGGGGGTGACACGACATGCCTCGGCCC
TGCAACGCAGCGAAACACTTTTCAGCGCTCCAAGCATAGAAGAACCTTGCATGCGTCCCCTTTTAATTCCCACAGCGCAACATTCAACTTGATGCAAAAA
TGATCCTAAAATCTACAACGTTGTGCTCTCCACGCGTTCAAATTGCAGACTGAAAATGCCAGCACACCCGCGCATGAGCCGGCTCCTGTCCTCCATTCA