Description :
From Genome Similarity Track
Location :
Scaffold_525:3176- 4894
Sequence
1718 bases(100 bases per row)
TTGGCAGGTTGTTTGGAGTACTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGA
GGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATAAG
GGCGGATACGACAACCTGGATCGAGCCCGGAGAAACCTGGGAACTGACAGATCGGTTAAAGTGGGTGGAACATGAGAAACAGTGGGTCACTCGGGGCGAG
AAATGGGTACCTACCGTAATCCAGGCGCCAGGTCGATCACAATACCTCCATGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGA
TCGGGCGATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGC
GACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTG
CAGAGGGATCGACGGGTCGAGATCCAAGCAATGAAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAAATAACGCAGGGTCGGTGGATG
AAGGATTGCAGAGGGTTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGAATCTTATCGAGAGT
GGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTTTCCCTGATACCAGGGTACCTGATTCCCCG
AAGACAGAAGGACTGCCAGGCGAAAGAGGGCCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCG
GGGATCTACATGCCGAAGATCTGGGAGAAGGCATGGCGGTGATCACGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCC
AGGGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCC
CGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCGGATCTGA
TTAAGGGCCAGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCT
GTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGG
TACTGCTCTCTTGACATAGCCAGCGCCTCTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGA
GTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCCATCTATGGATTCACCCGAATACCGGAACCCAAA
AGGGGTGGACCCGGGGAA