Description :
From Genome Similarity Track
Location :
contig_38:317522- 331410
Transcript NameFunction/comments
g7117.t1AP-4 complex subunit epsilon, putative
g7118.t1hypothetical protein PHYSODRAFT_293792
g7119.t1conserved hypothetical protein
g7120.t1hypothetical protein PHYSODRAFT_309106
g7121.t1hypothetical protein
g7122.t1hypothetical protein
g7123.t160S ribosomal protein L17-2
g7124.t1hypothetical protein PHYSODRAFT_353490

Sequence
13888 bases(100 bases per row)
ACAGCAGATCCAGCGTCTTGCGCTTTAGCGTCTCATCCGGGTCCTCTAAACAGTCAATGACAGCCATTTGGTGTGCTGCAGCGTATCGAGGGTGGTCCTT
AACGATGGCAGCAAGTCCTGTGACACCCAAGTACTTCAGGTTGTGGTTATCGCTCGAGATGAAGCGCGAAATGCTAGCAGCCGCGGCATCCAGCAGTGTG
CTGTTCGGGTAGATGGTAGTCACCGTCTGCACGCACTCGTAGATGATAGCGTAGCCCACATTGATCCCAGTGTCAGCACGACGCATGACATCGTGCAGCA
CCTCGTACATTCCTTCACTGGTCTGCTGGTCAGCCTGGCCCAACAGCGCCAGGATCTTCAGCAAACGAATCTGGATCCAGGGGGCCGGGATGCGATGGTA
GTCGAACTCACGAGGCAGACGGTGCTCCGTGATCTGCTTGAGAATACTCACAAAGCTGGGCACGAGGTCCTTGTAGTCCGTGGGGATGGCCTCCGCCAGG
TCGTGCAAGATGCAGAGCGTAGTTCCCATGACACTGGGTCGCGGTCACACAATGTGCGACGCAGCGCGTCTCCAACGTCGCTGACCGAGTCCGGGTTGAG
CTGGTGGAAGCGATGGATGGCCATGACGGCCTTCTTGCGCACGAGCTCGGCGTCGTGGCGCAGCAGGTCGAGGATCATGGGTTGCACGGCCGGCACCATC
TCCACCGTCACGAGCTTGCAAACGGCCATGAGCGCCGCGCAGACCTCAAGGTGGTTGGAGCTCTGCAGGTCTCTCTGCAGCTGGTTGATGATCATGAAGC
GGAACTCGTGCGTGGGCGACAGACACAGGCTGCACGTAAGGTAGCCCACGCGCTTCTGCATGAGGTTGGTGCTGGCAGTCATCTCCACCGCCTTGATGTA
GCCGAAGGACGCGTCGTGGCCCAGCATCTCCACGTACATGAGGCGAATGAGGAACTCGCGCTTGCGCTTGTTCACAAGGCTGCTGGACGTGCTGGACGAC
GCCGTCACCTCGTTCAGCTTGCGCTTGAGCTGCGCCACCTCATGGATGATGATGCGGTCCTCCTCTTGCTTCGACTTGCTCTCGCCGATCGACTTGACCA
GCTCGAAGAACTCCTTGGATAGGTGCCCGCCCGACATGGCGCGAAGCTGACGTGGACAGCGGCGAGATCGCGGATTGAGGGGTGTCGGCACCGCGCCACG
TAGTGTGGTTGTGTTGGCTATCCGACCAATACGATTATTTATATACGGGTTTTTAAATAAAATACAATAAATATTGGCTTTGCAAAAGTAAATCTTTGTA
ATGGTCGGATAGATGCGTAGTTTACGATCGCCCTATGGTGTGGCATATTCCGTCGAGTGGCATATTGTGAGCTCATAAAGTGACGATGGACGGCGTGGAG
CTCTCGGACGGAGTGCTGCGCTCCTACAGCGTCGCACGAAACTTCGTTCCGCAGGTAGGACGTCGGTCTGCCAATAGCTGCTACTATTTGCTGGTGCGTA
CCGTTATACTGAGAGTGTTGTCAACTGCGCAGGAGGACGAAGATACGAATGGGCAGATCACGTCCCTAGATTTCCATCGCAGTGGCGAGCGGTGCGTTAC
GAGTCGCAGCGACGGCGTCCTGTCCATGATCAACTGCTTGAGTGGAACGTGAGTTGCATTACGCGGTGCTCTCGTATTGCTGTCGACTAGACCAGGTGAG
CGTAGCTGACACCTTGCTATGCTCTCCACAGAGTCGCCAAAACGATTTTGACCAAGCGATACGGCGTCGGCATCGTGCGGTTCACCCACCACCCGGACTG
CGTGATCTTCTCTTCGGCTAACAATGCCAACGATCGTACGCTGCTGCGGTAGTGGCTAACTGGAAGGTGTGTGTGTATCCTTGACAGCGTTGATGTTTGT
GTTTGAGCAGACCGCATTCGGTACCACTCGTTCTTCGACAATAAGTTCCTCCGCTATTACACTGGTCATACCGACAGGTAGCTTGAACCTCTTAAGCGCC
AAGCTGCTTATTTAGTTGGGAGTTAATGCTCATTCGGTCGTTGCATGCTCCCAGAGTCACATCGCTGATGATGCACCCCACCGCAGACCAGTTCATTTCC
GCTGGAATGGATGGCACGATTCGACTGTGGGATATCCGTAACTCAGACACCTCGGTGCGTCGCAGTCCGTGAGTGCCCTTATTTGCGGCATTTATCTAAC
CGATATTGTTTTGCTGTGTAAAGGCTATCATTCGAACCGATCACTTGCCAGTCTCGCATATCTGCGCTGCGTATGACCAGGAGGGTGTGGTGTTTGGTGT
ATACACGGACGATCACTTGATCCGCATGTACGATGCGAGGAATTACCAGGAAGGACCCTTCGCCAAGTTCTCGCTCTATGACGCGTCGGTCATGGCAGCC
GTGGAGCCGTTCCTCGCGCAGATGCAGGCGCCGAGCTTGAATGTCAAGAAGCTGCACGCACTCGACATGAAATTCAGTCCCGATGGTAACCAGTTGCTCG
TTACAACCAACCGCGGAGTGTTCATCCACCTCGATGCGTTTGAGGGCAAACTGCTGCATCTCTTCAAGGAGCATGGCTTGACTCAGAGTCAGCGCAGCGA
ACCCCAGCTCGGTTGTTGCTACTCGGCCGATGGCGCGTATGTGGCCACGGGAGCGGAAGACGGCAGGGTGTTCTTCTACAAGAGTTCTACCGGTCAATTC
ATGCACACACTCCCGCAGGGCCACAATGGGCCCGTGGTCGATTTGCAGTGGAACCCAAAGCGCCACCTTCTAGCAAGTGGTGGAGGCAACTCGACAGTGT
TGTGGTCGGCGGCTGGGGTATGAGGACTACCGTGCCGCAACAATAAACTTGCAAGTTTTTAAATTTTGCTACAATTCATGTCCTTGCCAACACTCTGCCG
CTACTGCTGAGAACTTAAGTTCTTCCCAGCCGTTGCATCACTTCGGTTGCTGGCGCGCGACCTTCCGGTTTAGTGAAGTTCAGTCACGTGTTTAGTCACG
TTGCTGGTTAAGAGTCGCACCAGAATTGTTACCGAATAGTGGTCTCACCAAACAATTCGTCCGGGTTAAACTTTTAATGCGCGACCATTGGGAGGGTTTT
GGAAGCACCATTGGGTCTTTCCGAAGTCGAATTTCATGCAAGAAAGTGCCAAAGCAACCACAAGTAGGGTGTTGGAATGCTTCCAGTCGCCCAGGCACGC
AATGGGCGAGTATGAAGTATGCACGATTTACAGCAATTCGTACTCGAGTACGATTTATAGTTGTGCAAGACAAGTCGTACGAATTAGAGGCGAGAGAGCC
AAAAAAAAAAAACTGCAAGCACAATTCCGGTACATGTATTATTATTAATACAACACAAATTGGTTTTTAGGGCCTAATCTCAAATCGTCATCTTCAATCT
CATCTGTTCGCACCGAACTCTTGCAATTTTGTGTGCCTGGCTCATCGACTCTACGTATGCACGAGTGCGCTCTTGCATTTCTATCCACTTTGCTTTCGTT
TCGCGAGCTGACAGTCGTCAGACATCCATACGACTATGCTGTACGCTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTCCGCAAGTCAAC
TCGGAGGACTACACGGTCAAGGCCGATCCCGCTACGACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAG
ACCGTGAAGACATCGCTGACCTACTCTTCACCATGAAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCG
CTACAATATCGGTGGGTCTGGCAAAAACGTCATCGACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAA
TCGTTTTGGCTCGATGGTTGAGCAACGACACAGCCAGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCG
TGACGTTGACATCACGGAGGCGTTCTCAAACTCGCCACCATGGTGGATGAACAGCAACCACGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTG
CAATCCTGGAATCATGGACAATTCGCGCTGTACCTGGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCA
ACGAGCCTATGAGTACGTGGTGGCAGTATCCAGGTGGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGATGTCGTATTGAAACTGCGCTCTAAG
CTGGACTACTTTGGGCTGCAGGACGTAGCCATTTCCTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAG
ATGTGATGACTGCCATCGGAAAAATTAACACACACGGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAA
GTTTTGGGACTCCGAGTACGGCGAGAAGGACGCGACGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTC
TACTGGCAGCCGTTTGACGGCGGGGGCTGGGGCCTCATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTC
AGTACTCGCGCCACATTCGACCCGGCATGGCGATCCTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGC
AACAGTGAACTCAGGCGACACGGTTTCGAAGGTCACTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGC
GGCACGGGTGCGCTTTACAAGTCCTCGAAGGTCGAGCTATCTGGCACGTCTTTCAGTGTGTCGATCCCGTCTGCGTCGGTGATGACTTTCGAGATCGAGG
GAGTTACTGTTTAGACTTCGTGTTGAAATCGGTGATTTTGAACACCTTGGAAGAGTCTAACAAATAATGAAACGGATCAATTACATTAAGCTTTTTGTAA
TCATCTGATCTAATCGAGGTTGCCTGGTTGAGCTTTCGACACCAAGCAATGCGTGATCTTTCACCGTGCCACAATCAACGCTTCAATCATGATGATCACT
GCCCTGTTCTCAGGTTTTTACACACTGAATGTTGATCAGCCGGCTTTCGAACCACTACAGAACAGATCGGAGAAAGCCCACGAAGTACGGGTACGGCACC
TGGGGTACCTCGCTTGAGAGTCTCAAATCGCGTCTTTCACCTCTTCATCTGTTCGCACCGAACTACCGCACGATGCCTGGCTCACGGCCCGCAAGTTATC
TTTCAGGCTCCTGCATCACTCTGACAATAGCTCGTAGCACTCCTTTTCGGTTCCCACTTTCGCTTTTGCTCTCCGCACTTAGAAGACGTCCCAGTATTTC
GCCATGATGCTCGCAGCTTCAGTGTTGTCCTGTGTGCTGCTCGCTGTTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGA
CGCTTACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTGGGCCAACGTCTTCGGAGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAA
GGAGACGGTGACGTTGAACGGCTCGACTACCGGCCCTTCCGGCTTTGGGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCGTTGA
CGACAGTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCGGCATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACA
AGCACGAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGGTTGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGC
CGCCGTGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGATGGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTT
GGCCACTGTCGTTAGTCATGCCAAGACTAGCTGGGGCATTAACATTACCTATGTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGT
GGTCAAGAAGGGTGTCACTTCGAAGTGGACACACAAAAGGACGTCTTGGTTAGACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTT
CCTCATCCGATGAAAATTCGCCGACGCAGACACTGTCCACACTCACCTCCATGTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCA
TGGTTACGACGGCCAGAGCCCGTACCGAGGAGGGGACCGCGGCTCCTTGAAAACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGC
GAGGACGACGCGACCGGGCTAAGTCTGGCTGAGTCGATCGCACTCGACATCAATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTG
GAGCTTGGGGTCTTGTTCAATCCAACCCGGGCGATAGCTGGATTGGCACGCCCAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACC
CGGTATGGCTATCCTATCAACAGATGACACGAATACCGTCGTGGCTTTTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCG
GCATCTGCGGTCACTTTCGACTTGTCCAGCTTCACAACTGTGGGAGGTCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGT
CTTCGAAGGTGGTTTTGTCAGGCACGTCATTCAGTGCGTCGATCCCTGCTGCGTCGGTCATGACGTTCGAGGTACAGGGCGTCGCAGCGTAGTTTCCCTT
TTCAAGCCACCGCAAATAAACATCATTTTCGACTGCCCACGATTTGCCCAGGAAAAATAGGCATGAACCATGCAGCCAGGGTCTGGCGACCGCCAATACA
AGTTGAAGTTGCTCTATCTTCATGCGGACTTGCAGCGCCTTGGTCTTCGTGCTTCATATAAGGTTCGGCGTGAGTTCTCATGTAGGCAGCTTGCAAGTTG
TTGTTCTCATTGTGTAGGCTTGCAGGTTGAAGGCCCCCGCACATAGGGCGTGTTCAGCCAATCAGATCTTCCCTTGAAACCAACGAAGCCAACACAAAGT
CAGTGACTGGGGAACCCGAGGAGCTACGAAAATGGTGGACACGTCGGAGGTCCCGGCGCGTCCGGGTCAGATAACGACCGATTTCCTGCAGCAGATTCTG
CGGCCTTCGTATCCTTCGCAGCGCGTGGTCGACTTCCAGTGGACCCCCATGAACATTGGCGTGATCGCGGAGGTGGCGATCATCACAGTGGAGTTTGAGC
GCGACGACGGCAGTGGCGAGGCCAAGAGAACGCAGCACAAGTTCGTGGGCAAGTTTCTGCGCCCGGAATTCCCGTTCGAGTCGATGTTCGCGGTGGAGTC
CAAGTTCTACAACGAGTTCACGACGAAGGCAGGCGACACAGCCATGAGGAACTCGGCGGCAACTGTGGGGTTTCCGTTCGCTATCCCGACTGTAGTCTTC
ACATCCAACGTGCTGATCGTTCTGGAGTTTATCGATTCGACGAAGACCTTCACTTGCGTGGACGGAAGTCCACCCCAGCACATTCCGAAGCTGGTGACCA
AACTCGCGCAGATGCACGCGCGCTTCTGGAACCACGACTGCGATGGTCTCGCCGTTCCAGCGGGAATTGGCAGTCAGCTTACTGGTGAAGAGAAGCGCCT
GCAATTCCCTGGCTGCTGGGCTGGTTACTTGGACGACGTGCCACTGGAAGCCAGTGACAAGGCGCAATTGACAGCGTTATGCCAGCAACTGAGCGAGAAG
CCTGATAAGCTTAAAGTGGTGCACGACAAGGTGGACGATGGCCCGTCTTCGTTGATCCACGGTGACTTTCACATCGCAAACATGCTGCTATCGACGGATC
CTGCAGATGAAGTAACATGGCTCCTGGATTGGGCAACCTGTGGTAAGGGCAATCCACTGCGAGATCTTGCCTTTTTCTTTATCGTCAGTGTCCAAGCAGC
GCACCGCCGAGAACAAGAGGAACAGTGCTTGGAGATGTACCGCAATACATTAACAACAGAGCTGGAAGCTGCACAACTGCCGCTGGATGAACTGCATCGG
CAGTATAAGATGTGCGTGTTGAACCAGTTCGTGATCCTGGTCGTGTACGACAGCCTCAGCAAAAGTCTCGCGGCGAACGCCAAGACCGAAAAGATGCGTG
TGGAGCTGGATGCACATTTTCGAGAGGTGAATCGCCGCGCGTGCTTGAGCGTCCTGGACAACGTCGTCGAGAAGGACCTCCAGCTTCTGCAATGAAGGCC
TTGCCTGAAAAATCAGCTGCTGTACGTGTAACTTCGATGGGTTTATACAATCGGAATCGGCGACTTGCTTGCTCCCAGTCAATTAAGGGCGTGTCTTCTG
GATCGGCTCGTTGCACAGCTGTTGTCGATACAGATTACGAGGCCGCTCGCATACGAAAGTAGTGTCGGTCGGCTACCGACTCGGCAGGCATGGGCGGAGT
CAAAGGGATCAGTTGTATTTTTACTCACAGCTATTGATACCGACCGGAACGGCACAGTCATCGCTCATGAAACCCTATCATTTCATATGTGTTTCTTATT
AATTTGCTGATATATACCTGTAATAATGAATATACCCTCATGTATAAGTTTATTTATTTGGATGATAAAACGAAGCGCTTACAGTACTCATTGTGCAGCC
TGCTGTGCCCGCCCGTCTCGTCCTGTGTGGCATAAAACGAAGAACCGAGAGGGGAGCAGGTGCACATCTCGGGCGCGAAGAAGAGCGGACATGGCGCGCT
CGATCCCCAAGCCCAACCCGATCCTGGACACCCTGCTGGTGAGTCTGCTCGTGTGCGAGCTGGTCGTCATCGTGCACACACTGTGGGATGACAAGCAGAT
GCTCTACATCCTCGTGGCCATGGTCTTCGTGGTGGCGCTGGCCGTCAAGGCCACAAAACCTCGTTCGCCATCGGGGGCGGATGGTTTTCGCGCACGTTCT
TGCAGCACCTCGGGGACCCGCTCAAGAAGGCAGTGACTATGAAAAAGTGGTGCGACCAGTCGTGGCAGCTCGCCATCCACGTGTCCATGACGATCTTCGA
GCTTTATGTGCTGCGCGATGAAACCTGGTGGCAAGACACGACGACTTGTAAGGAATGGGCAACCTGAAAACTGTGTGGTGGGAGGACAAGATATCTTACT
GTGTCTATTATGTTTTCGTGTGGTGAATGACACTGCAGTGTGGAACCAGGGAACGGACACGGGCGTGTTCCCGACGCAGAAGTTTAGCACCAAGCTGCTT
TACATCACGCAACTGGTGAGGGAGTGGCGTGCTTGTGTTACTGCGGACTTATTGGAAGCTGGTTAACGTTGTTTTGTACTTCGTAGGCGATCTGGATTTT
CACTGCGTTCTCGTGCAAGTTCCTAGAGGAGATCCGCAAGGACTACTTAGTGATGATGACTCACCATGTCGTCACAATTGCGCTGGTCACGTGGTCGTAC
GCTGTTGGCTTTTTGCCTGTGGGTGTAGTCGTACTCCTTCTGCATGACATGACTGACATCCCTCTCGACATGCTCAAAATGGCCAACTACCTCAAGATGG
AAGGCGTCCCGGGTCTGTTCACGAGCGAAATCCTGTTCGTCATCACGATCGTGCTCTGGTTCTACTACCGCATCTACCAGTACCCGGTCAAGCTGCTCTA
CACGACGATTGTGGAGAACCGCGAGGCCAGCATGACAATGGCCAACGCACATGACTTCACGCAACTGTTCCCGTACCCAGGCCCTCCGTCGTGGCTGCTC
TTCAACGTGCTGCTCACGACGCTGTACTGCCTACACATTTGGTGGGGCCTGCTGCTTGTGCGGGTGCTCGTTGGCGTGGTAACCAAGGGTACCCACGACA
CGGCCAAGGAGGAGTACGAAGGCACATCTTCCGACTCGGACAACGAGAACAAAGACGACTAGAAAGCAACTGCATTGTTGGCGTGAAAGGACTAGAATGT
GAAAGAAGACAGCAATTTGACCAGAAGAGTAAGAAAATCGTCTTCTTCAACTTGACCTTTACAACATCATAACGTATGCTATTATACAGGCCAATATTTG
GCGCGAGCATTTTGACAACCAGTGGGATAAGAAGGTCGCCAGCAACATGATGGAAGGCGTTGGGCGATGCACCGCCGGTGTCGGTGCAGTCGCTGGTCAC
GGAGGTGTCGATCGTAAAGGCCCTGCGAGAGTTGCTTCCGACCATGGACGCAGAAACGGCGACTCTGAAGTTGGTGATGCAGAAGCTGGCGGTTCGCTTC
GGCATGGAGTTCCGGGATTTAAAAGCACAATGGAGACCTCACATCAAGGCGGTGCTGCCGGAGATGCTGGACCAGTGTCTGAGAGGAGAAGCGTCCGAAG
AAGAGGGCGAAAAGGACAAACACCGGGCGGAAGAGGAGGAGGAAGTTGATCTGCGGCCCAACCGGAAGCGCACGACTAGAAAGCACAATGCAGTTGTTGA
TGCGAGTGATGAAGAGGCGGAGGAGGACACTGCTAGTGACAACGATGCAAGTGGAGGTGAAGAAGCTAATCCCGAAGAAGACGATGAAGAGGAGGAAGAC
GATATTGCTCCAGCCAAAAAGAGACTGAAAGCGGTGCGAACGTTGCTTTTGTTGGGTCTGACCTTTTCTCCTTCTTGTTACACCCTTCGAGGTATTATAT
GCTGATGCCTACTTTTTGCTGTTCTGGTTGTTTTTGCTTGCAGTCGAACAATGGCCACTCGAGTTGGAGATCAAGTAAAAGCGATGGTCCGCCGGTGAAG
AAAGCCAAGACTGTCAAACAACAAGATCCTCCGGGACTTGCCTCGTTGAAGGAACTGGGCCGTGCAGCTGGTGTAATGAAGTACGGGCTGGGTCCTATAG
TATATCGAATTGTGTGGAAGTTCATGCTAACCAACTCGATTGTTTTGGGTTTCAGTCCACGGCTGTACAGATTTCTGAACGGTGCCACATCGACTGAAGA
CTCAGAAGAGATCCTGCGCAAGCGATTACAAGATGCTGGCGTTGCCTTTAATGGCACGTATCCATCAAGCCGCGATATCAGCGCCGCGAAGAGAAAGCAC
GACAAAGCAAAGGAGCTGGAGGGCATCGACACAAACCTGATTATTTCGGGCGGGAGGTCCCGTCGTGGTGGCTCGCAGCACATTTCCTACAAGGAAGAGC
GGATCAGTGGGGAGGAAGACAACGCAGAAGAGGAGGAAGATGAAGATGACAAAGACGCCGAGGAGTTCGGTGGCAGCGACTCGGACTCGTCAGAGGCGTC
ATTTTGAGTTGGCTTTTGCGTAGTGGCGATGTGAGTGCATATGCAGTAGTAGGTGGTCCTACCGCAAATAGAGAATTGCTTTCGTCTTGGGAGTGCAACG
TTAGTGTTGTTTAGCCCTTTCGTTTTTGTGATACAAGCAGTTTTTGTGGGACGATATTTGTGCACATCGACTGTCGAATCTCGCTCCAGATCAATTTGTT
AAGGGCACAAATCGGGTTTGTGTCCCATAAAGAAAGGTAATTCCAGATCTCACTTGCATTTCGTAAGGCGTCAAATTAAAATCATGTGATTGGATAAAAT
AGAAAATGAACCACATGGGATTGGCCAAAAGTCGCCGGTAATTGCTTGTCCAGGTGATTGGTGGTGGGAGCGCGTGGCCTGTTTGGTCCCGGGCGGCGCA
GCATTTGCCGCTCCAGTTTCCAGAACCCGAACGTGAAGCAAGAATCATGCCGTCCTACAGCCAGGAACCTGAAGACGCTCAGCGCGCCGCTAAGGCCCGT
GGCTCGCACCTGCGCGTGCACTTTAAGCACTGCCGTGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAACAAGGCTAAGAGCTTCCTGCAGGCCGTGC
TCGAGTACAAGCAGGCGGTGCCCTTCACCAAGTTCACGGGCGGTTGCGGCCGTCACGCTCAGGGCAAGCTCCGCGGTGCCGCTGGCGACAAGTGCAAGTG
GCCCCAGAAGGCCACCAAGATCATCCTGGACCTGGTGAAGAACGCCGAGGCCAACGCCGAGGTCAAGGGCCTGGACACGGACCTGCTGTACATCTCGCAC
GCGCAGGCCAACGCCGCCATCAAGCAGCGCCGACGCACGTACCGTGCGCACGGTCGCATTGGACCCTACATGTCCAACCCGGCCCACATCGAGCTCCATC
TGACGGAGAAGCGTGCTAACGTTGCCAAGGCCGTGGAGGAGGTCAAGCCCACCAAGGTCTCCCGCAAGCGTCAGGCTCAGCTGCGCCTCAAGTCGGGCGG
CGGCGTCCCGGCCAACTAAGTTGATTTCTTTGCTCGGGATATCTCTTGCCTGAAACACGAACGGTCAGTCGGGAACGAGCGACTGGAGACGCGAGGGGGT
GGCGAAAAGTTTGGTAAAACTTTTTAATACAGCCTTGCCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGCCAAGAGAGCAAGCGAGTTTCCAGTTCG
TCTTCATGGCGTGTCCCTGCGTAGGTCGTTATGGTTTGCTTTGGGTGCGTACAGTAACAGGTTTGATAGCGGCGGGACGGAAGTCGGGACTGAATTTGCT
GCGCCGGCTTAGGAGATGACAGGGGAGAGTCGTGATACCACCACTATGAGGTCGTCGGAAACTGGGGTAGCTAGGATGGTGGAGCGATATCCTGTGTGCT
GACGAAGACGAGATCACTGATGACGGCGTGGCTACCTGTGACGTTGAAGACCGAAGAAAGCAAGTCTAGCCATGCTTGTAGTCGATGCCGCGTCGGGAAG
TGGACTACCCACACTTGCAGCGTGCTCGGGTCTTGGACAGTCATCACCACTTTCGGACACTGCGAGCGTCAGTCTCCTCCACAAATGTGACGAGGCTGAT
ATTGTGAAGACGCATTACGTGCTTGAAGTTGCCGTAATGCAGGAGATGTTGTGTCTGGTCGAGTTGCAGGTGTTGTATTCGCTTTTGCATCTTTGGCATG
AAGAAGCCCACGGGCTCTTCGATGTGGAGCCACTCGCTGCCGGTGGTTGGGCCCTCGTCTTCACTGACGGTGCTGTCCTCTTCGCAAGTGTCGTTGTCAC
GTTTCGACTTGTACCTTGATGGGCTGGAAACCGTCGCCATATCGCGCTGAAGGCAAGCATGATTCCTCACTGCTGCTCCTTGTAGTCAAAAGAAAACATG
CAACTACGCTGCATGCATGTCCAAATTCAGCTTGCAACTTCGATAGTCCTCAAAAAGCTTGTTGCGTTGGTGCGTCATAAGAAGCTTTTGCCCATGCTAG
GTCATTCACCGGAAATAGACCTCGACGTTGGTAGTGATGCCAGCCACGCTGCAGTCGCACTGCCTTCATGACAATACAGTATCAACCGTGCAGTCTGCTA
GCACACATTTAAGCTAAATTACTGCATGCAGCAAGAGTTCGTGTGGCGCGTAGTGTCCATGGTGGTTAGTGCTGTAAAAGTGGACTAATTTTGATCTCAG
ACCATTTGGGACCATTTTGGGGCGTTTGACACTAATTTTGGCGGGAAAGCGCGCATTGGTCAAGATGAAACCGAAGACGCAGAGCTCTCTGCTGAGTTTC
TTCAGCCCTCCGTCGTCCGAGGGAGCGTCGGCCAAGAAGAAGGGCGCACCTGCAGCTGCGGGCACGGGCAGTAGCAGCAAGAAGAAGG