Description :
From Genome Similarity Track
Location :
Scaffold_32:31743- 49394
Transcript NameFunction/comments
Phyke_g1827glutamate-rich WD repeat-containing protein
Phyke_g1828hypothetical protein PHYSODRAFT_488541
Phyke_g1829hypothetical protein
Phyke_g1830hypothetical protein PHYSODRAFT_490644
Phyke_g1831hypothetical protein PHYSODRAFT_247505
Phyke_g1832hypothetical protein PHYSODRAFT_492612
Phyke_g1833hypothetical protein PITG_10009
Phyke_g1834protein kinase
Phyke_g1835hypothetical protein PHYSODRAFT_313779

Sequence
17651 bases(100 bases per row)
GGAAAGGCCGGTGCTCCGTTGCCTGCTAAGCAGTCCCCTGTGTACACATTCTCTGGCCATGCGGACGAGGGTTTCGCCATGGACTGGTCTCCGGTACAAG
CCGGCCGTCTGGTCACTGGTGATTGCAGCAAGTTCATCTACCTCTGGGCAAACTCGGAAGGTGCGTGGAATGTAGACAAGGTACCGTTTACGGGTCACAA
GAGCTCGGTAGAGGACTTGCAGTGGAGCCCCACCGAGACTTCGGTGTTCGCATCGTGCTCGTCGGACCGCACAGTGCGTATTTGGGACACTCGACGGAAG
GCTGGCAGTATGCTGGATGTGACAGCGCATGACGACGATGTGAACGTGATCACTTGGAACCGCAACGTGGCGTATCTGTTGGCGTCGGGGTCAGACGATG
GCTCGTTCAAGATTTGGGACATGCGAAACTTCAAGGCCGACAACCCAGTGGCACACTTCCGATACCACACGGCTCCCGTAACGTCAATTGAGTGGCACCC
GACGGACGAGTCGGTACTGGCTGTAGCAGGTGCTGACAACCAAATCTCGGTCTGGGATATGTCTGTCGAAGAGGATGCCGAGGCCGCTGTCCCTGTTGCA
GGTGAGAATGGTGAGGCGAAGCTGGACCTGCCTCCGCAATTGCTATTCATCCACCAGGGCCAGACTGACATCAAGGAACTGCACTTCCACCCGCAGTGCC
CAGGCGTGCTCATGAGCACGGCCGGCGACGGCTTCAACGTCTTTAAGCCTGCTAATATTTCGTAAATAAATCGCTCACTTTTTGTGCCGAGCCTTGTCGT
CTTCGTGAATATGAATAGTTCCTCATTATGCCAAGTTCGGATGCAACTTGTAGGGCCACTATTCAGGTGGATTTAATAttgatgtggtccacatcaGCGA
TACATCCAGGGAGTCTGGACATAACCAGATGAGGGAGGGGCGGACCTCGTTCGCATTATACTCTCTGCTACTACGTGCCTATTCAATCTCTGTCTGTTCG
TCTCTAGTAACGCACATAATAACCAAGACACTACAGAAaccatcagcttcttcacactcGCTACGATGCTACACAAGACTCGCACCAGTCGATGGCATCT
CGTCTGTCTCGTCATTCTGGGGGTTCTGGACCTTACCGGTACCCAAGCTAAACCATTGACAATGTATGGCTACGGGGGCTACAACCAAGGAGGCCACATG
CGTCACGACAGTATGGAGTTCTACGCACCCGCAGACCGAGGCTGTGCTCTCTGTCGCAATGGAATGAATTGCTCCATGGCAGTGCACAATGTCTCTGCTG
GAGTGTTCTGTGGCGACGTCTTGTCCACATTCCagccatgctgctgctcgtttcGGAACGAGTGTATGACCACCATTTTTTCCGACTCGTGTGAGTGCTT
TGATGGTGAGCGAGAGCAGGAGATCATGACGACAAGGTTCTATCTCTTTGTGGGGTTGTCCCTAATTGCTTGGGCCCTGCTGGTCTACGACAAAATGTGT
GCTGGACCGTACAAGATCATGAACAGCAACCACCAACTACTTGCAAGCTCACCGTCTGCAGCACAAGTGAGAGGAGAAAATAGTGTCGTGGATACAGTGG
ATAGTGACTCAGATGATGAACGGACGGACCAACATGTTGATAGTATGGCTGCTACAACTGCTGCTATAGCTGTAGAGGGTCAAGAAGAACTtacagaaga
agatgataGCGCGACTGCTCCGCTTCGACCGAattcatcgtcgctgacagcagctacagatAGTAGTGATGTCGAAGTTACTGTCGAGTCCAATGATGAG
ACAACTCGAGTTGCTAGCGAGCgacaagaacgagatcaGACTTCGATCCAAAGCGTATAATGGATCCGAACGTTTTCCAGCGGGATAAATGCAGCCTCAT
CGGGCATTATTATGAACGTTGTTTTGACTCTTTACTTTGATTTTGGATGGAATTCAATATACTGCCGTGAAAGAAGACGCGGGCACACGCAGCTGCATGT
AGCTCCCAATGTTAGATAGACTCTGAAATCGCACAGTGCCATCACGAAGACATGGATTGAGACTTTGTACACTGGTTTGAAACTGTATGGTTGGTGGGTG
GAAAGAAAACCTTGCTTCGCCGTCTCTTGGAGAATATTATTGGAATGATAGTAGTTATGATACTTACAGCTATACTTACAACTCGGATAGATAACTTCAC
GCACGATGTCTAGACTTTCCGAGACTCCATTCCTTGCAactccacttcatccagatcTACTTCAACCAGGTCATCACCTAGATCCTCTTCGACTATACTT
GGTAGCTCTGCGTCTTGCAGATCTGAAAGACTTGTGCCGACTTCTTGGACATCATCAGATGAAATGGTGACAACGACTACTTTTTCCTCCTTGTCGTTGT
CAATAGTGACAGCCGAGTCAAGATCATTATCAAAAGTGAAAACGGGCGAGCgagctggtgcaggagaAACAACCAACAATGGCCGATTATCTTCATTCTC
AGTGTCGGTGTCCGAGTTCTGCCGTCGTTTGCCGAAGCGCTGTCGGAATCGTAGCAGTTTTTCGCCGGTAGTTGCCCGATAAGTGACCATTTGATTCCGT
CTGCAATCACTGAAACAATCCACACACTGGTCCACGTAGACTGCAAACACAAAGAACGCGAGATACGCTGACAAGTGTATCAAAATTTCCGTGGTGACTG
CCATTTGTGTATCCACAGCCTCAGCTTCCGGCTCAAAACTGTCTTGAACTTGGGTCTTTGTATTGTGCTCTTCGTTCATTGATGCCAATCTCTCGTGTCT
CTGAAGATCTAATTGCGCTGCAAAGGGCCACAGTCCTCCGCATTCACAAGTGAGTGCCTTGATCGTCACCCGACATTCAGTGTAGTACGGACAGCAGCAC
GGCTGTATTGTCGCCGCAGCATGCAGGTCTCCGCAAAACACTCCTGAAGACGTATCGTTCATTGCAACCGAGCAGTTCCCGCTGTCCCGACACAAGGAGC
AACCGGCAGTGAGACTTCCAGTGGTACTGACTGCTACATGGAGAGGATCGACTTGAGAGGGAGACAACGCAGCGCCTGGTTCTTTTAAGAGGTCGACCGC
TACGACTTGTGATGCACTACAGGTTAGCAGAAGCACGACAGAGCGCCGCAATACTGCCACCATCTCACTGAGGGTGCAATTGGATTATGCAACACTGGAA
TGGGGGAAAGTGTTAGGATGGGAGCTAAAGGGTCAGCAAAGGCGTCGTGCCAGTGTCCGCGTTTCCAGAGACCCATTGTATGTTCACGCCAGCCGATGGC
CAATTTGAACCGCCTCGTTTACACATGGTACCACTATTAGAAATTTTATCCAATTGTTCTGTGTTGATATTACACGTTATCACTGGATTGGCCGTTAATC
TACCAATCAACGCGAGGTAGTCGGTTCGACAAGTGTAGCATACCGAAATGGACTGAACTTCAGCCATCAGTCAAAGATCTTTCCAGCCTGTAACCTTCAT
GCGCTGTTGCATCGGCGCAGTCAGTACAAAAATCTTCGGCGTCCACCTTGACTATGTATGTTACAATCGATAAATGCAAACAGAAACCGAGTCTGTACAG
ACATATTGTAGCATAAGCACAAAATTACAATATCCTGACAGTTTCTGCCACGCCGACTGCGGTACGCGGTCAATCTTATTCATTAAGCCAGTAACGGCAA
TATGTTACTGTGCGCAAAAGCTATAAGCAGTAACTAACCACCGTTGTGTTGCAATGCTGATCTTACTTGCGGCGTTTACAACATCCCGTCATCACTTTTT
GGGCCGTACCAAATTAGCGGTACATAGTCACAATTCTGGGTGAGTCACAAATCTGTGACACCGTCGTCAATACCTTGTCAAAGGACTGGGCATTCCCGTT
CCTCCAAGATGGCGTCGACGACCCGGCAGGCGACactcttgctgctgctgacgctgcaggtGGGCGTTCAGCCAGTGCTTATGGGATGGTACGCCAGTGA
GGCTCGTGACGTCCGTCTGCGCGTGGGTGTCGTGGAGCTCCTGAAACTTCTGCTGGCTCTGGTACCGCTGAGCTGTTCAAGGGGAGAGGCAGGACTACTG
GCCCAGCTTAAAGGCTGGCGACTACGCGCTGCACTGGCCACGACGGTTCTACCGGCACTTATATACGTGCTCCAGAACCTGCTGAACCATGCGGCGGTGG
TGACGCTGGACGGTGTGACGTTCAACGTACTGAATCAGACCAAGATCATCTGGACGGCACTGCTCGTGTATCTGCTTCTAGGCAAACATCAGTCACCCCT
GCAGATGCTGGCGCTTGGTATGTTGTGTATAGCTGCAGTGCTCATGACGTCATCTTCGGTAGAAACGGCAGAAGAACAGGGAGCTGAAGTGAAAGCCAAC
GATGCGGCGGTCTTCACTGGTATGTACCAAGCGCTGCTAGCTGCTGTGTTATCAGCGCTGGCTGGTAGCCTCATCCAGAGAGCGTTGCAGCGAGAGAAGC
GCAACCAGTATATGATAACGGTAGAGCTCAGTATCCTGGGTGAAGCGACACTGATGCTCCTGGCACTCGTGCAGGGCGGATTGATGTCTGCTCCGGACAA
CAGCGACTCTCAAGACAGCATGTGGGAGGGATGGAGTAAAATGACAATTGTAGCGCTGATGTGTCAAGCGTTGGGTGGAGTACTGGTGGGCTTTGTTATA
CGGGATTGCGGAAATGTGGAGAAAAGCTTCGCTGTCGTGGGAGGAATGGGGCTTACGGCTCTCCTTGAGACGCAATTCAACGGAAAACCGTTCGGTCATA
ATGCACTAATGGCCATGGCCCTCGTGGCTATTAGTACAGCTTTGTATACGCTCAATCCGCCCGCGGGGGTGTCAGAAAACGAAAAGCCGATAATATCTAT
GGTTCCAGCAGACGTTGGAATTTCGGCCGCAGCGACGACGGTCCATCCTGCATCTAACATTTGGCatgcgaagaagaagatgagcTCAGATTCCAGTGAG
CTTGAGCCATTCTTGACTCCACCCACTGTCGTCACAGTCAGTAGCAATCGCgtacacagcagcagtagttCTCGGCAGGAGATGCGGCGGTCAGGGtggc
agttgcagccatttcatgaagcgccaacaccaccacgagATCTGGAGGCTATCGTTTAAGCCACAGCGGCGAGACTCCTGCACTCAATGTACCAACTAAT
TCAAGCTTAATTTTTTTACACCGGCAAACTTCGTTGAGTGTTCGACTTGCTGCCTTGGTATAGAAGACCAACCCAGTGTGCTTGCAGAGTTAAACACGAG
ACCAATTGAGGCTGGAATAATCTTATATTAAGCGTGTTCGTCGATGGAGATCTTCGTTGCCACAATTTTGCTGGGTTTCATTTGTGTTGTCTCTAGGTAA
AATGTGACCAGTTATCGCAGCGGAGCAAGCAATTTAGCTGAGCTGGACTGCGCGTTGCAGTGACTCAGTGAGTACAGCGCCTGTTAAGTCCTTGAGTTCA
TCTGCACTCCAGAGAGCGCCAACATGTCCATCCGGACGAACAAGTGCAGCACCATTGCTACCCATAAAGCTGGCCCATGCGTTGTTGTTGGCTTTGTCGG
TAACATCTTCAACAACTTCCCACGAGTGCACACAGCTGAACCCCGATAAGTTCTCTGTCTTTGAGATTGCAGTGTCAACTTTTGCGGCATCACCGTCAAA
ACTCGAGCGCAGCACAACGAATGACACATGCTTTGCCAGTGAACCAGACAACGAGCACGTATCCAAAACACGCGCAGCATCACGACCGGCTACGACCAGC
AAGAATTGCACGCTGCCAGCATCTTCATGAGTTGCAATACGCACCATATCAATAGTCGACACCTTCGAAGCAGAGGCTTGATTAATGCACCAAAAGTGAG
GGAAACGCTCTCCAACGCGGAACTTTGGGGAGTAGACGACGCTATCTCCATCACCTACCTCCGTGCGGAAGTGCACAGATTGGTCAAGCGCAGAGTCTTC
CATGAGCTTTTTGGCACGAACCGCCCATGTGGGTGCGTCGTAAGAAAATCCGATGTCGAAATGGTAGAACATCATTCCAAGGGTCTTACGGCGTGTCACA
ATATCTTCCACGCTGGTCCGCATGCGGTTGCCCAAGGAGCTGCCTGGTCCTCCAGTGTTCTTCGACTCATCCAATAGTCCCAGAGGCATCTTGCCGAGGC
GCATGATGCGCTGTGCAATCTCACGCTGCGCGCGTagtggaaggagctgcatgGGAGCTGAATTGATCACGGTAGCCAAGGTCTTGGCGTTATCGTGCGA
CACATTGAGGGCGCGAGGAATCTTCATAGTTCGTGCCACATTGCTCAGACTGAACTGAGTATTTGTTTTGGCAACAAGCTGGCGCTCACGACCATAAGAG
CGCAGCAACATTTGTGCGTCGACATCGCCAGTGCTAGAATCCACGTTCACATTTTTCGTTTGGATCGCCAGGGCGAGCTTCCAGACCAGGTTATGCATGT
CTTGCAGCCCTGTGTTCATGCCGAAGCCGCCTGCTGGAGGGAATTGATGCGCCGCGTCTCCCATAAGAAAAATACTTTGGTTACCGGCGTCGTATTGCTT
AGCCACGCGTGCCCCCATACTCCATTGGCCAACCGATAAAATATTCACATCGTCGTCGCGATAGTCCACATTCTTCGGCAAAACGTTACGCACGATTTCC
TTGCACTGCTCAACGGAAAAATCCCAAGGGATTGACTCTTGTGGTGGGAAGAATGGGATCTGAAAGACCCATTCACCGTGGTTCAGATCGTGCGCGATCA
GGATACCAACCACGTCCTTGTTGAACTATTAAAGCGAAAACCGGCAAGCTTAGATACCATCAGCTCAATAAATGTAGGGAATATCCTTACCACAAAGTAC
AACATGCCAGGATTTTCACGAGCAGCATCTGAGAGAGCCTTACTGGTAAAATGCACGTTGGCAATGCTCTGCAGATTACGTGTTCCAGCCATATCGATAC
CGCAGAGTTGACGCACGAGACTGTGCGCAccatctgcaccaacaaCGTAGTCATAGGATGCTTGCTCGAGCGTGTTTGAATCCCTGAAGACGACACAACA
AATCAGTATTAGAATGAAATCTGGATTCTGCAAATGTAGAGACCTTACAAGTGTCGTAATGTCACTTCTGGGGCATCAGATCCCTCTGGAGGCAGCTTGA
GACTCTCAAGTGCTACTCCACGCTCGACGTGCAATTCGTTTTCAGCCAGAAACTCATCCAGCAACGTCTCGAAGCGGTTCTGTGGGAAGTGCAGAAACTG
TGTGGGCGACAATGCCGCCAGCGATGAGCGGAGACTGTCATCGTTTACCTGCGCCTGCTCAACTGTATCACGTGGGATGCCTGTACAGCCATTTACAGCA
TGGTATTGAAAAGTTTAGTCCCAACtggactgcagcagctcctgaatGCGTCACGTACATGGTCCAAACTGGTCAATTCTTGCAATCTCTCTTGACTTGC
CCACCCCTGTACAGTAAATATAGTCTCTCCACTATATAACATACCATTAAACTAACAACATTAGAGCTCCATCACCATGAGTTCAGGCACATAGCAGCTA
CGTACGAGAGCACTGGGGGCAGCTTGAGCCAATAGCCGGTCGTGAAACTCTGGCATGGCGGCGTAGAGCACCTCCATAGTACGTAGGTTGATGAAATGCG
CCTGTGGGTGCGACGTGGGGCTTAGCTGACGCTCCACAACGCGCGTGGGGACGTTGTAGAGTTTTTCAAGCATAAAGGCGGTGGCAAGACCCACAGGGCC
ACCTcccaccaccagcacacgTGGTGAACGTGCTCTCAGCTTCGACACTAGCGGCATATTGCAAGGTACTGCACACGAGCGGTGGAGAATGCGCGAGCGA
TTAGACAAGCATGGCCATGCGCAATTGATACGCACAATGCGGACACCTCAATACAAGCCCATATCACAGTATATATTCATTTAAATACGAAGTTGATCAA
GAGTGATGATCACTTCAACCTTAAGATGGATACCGCGCGCTTCCAAGCTCTGGCGCTCCCTGCATCTGATGCGCACTCGGCTGCCTCTCAGCGTCTATTG
CAGGTGGCAGATGCGTTCACGAGACACTTTGGAGGACCTCCGATAGGTATTGTCCGCGCTCCTGGGCGTGTAAATCTCATCGGCGAGCACGTGGACTATG
AAGGGTACTCGGTGCTTCCGATGGCTATACAACAGAGCGTATACGTGGCTTTCGGAGTCTTTAACACGCCCCAGATAGACTCCTGCAGCGGGGGAGTGAA
TGTATTAAGTATAGCGAACGCCAAGACGCAGTATCGAGGGGTTACAGTGTCGTTGAAGGCACAGGAGAGCGAAAATATGGCGAAACTTGAGCAGGAGGGC
GCGTCCTGGGCCAAGTACGTGCTGTGCGGAGTGTTGGGGGTCAGAGACGAGTTTCCTGAGGTATTCCAAGGCAAGGAGAGggagttgaagctgctggtag
aCGGAGATATCCCTGCAGGTTGCGGGTTATCCAGTTCCAGTgcattggtggtggcatctGCACTAGCGACGAGTGGcacgttgaagcagcaacttccTGG
ACGTATGGAGTTGGCGGAGCTCTGTCGTCGAGCAGAGCATCGTGTGGGGACTATGGGGGGAGGGATGGATCAAGCTGTAGCGTGTTTGGCTCAACGTGGC
GTTGCTCTGCACCTTGACTTTGCCGTTGCCCCGGCTCAAAATAATCATGTTCGTCTGGGGAATGAGACAACTGGTGTTACTTTTGTGGTTGCAAATAGTT
TGGTGGTGGCAAAGAAAGCAGTTGATGCCCCGACACGCTTTAATAAGCGTGTGGTTGAATGTGCTATGGCTGCAAAAATGATTGCAAAGCGAATTGGTCT
AGAAAACTGGAGAAGGGTGAGTCCGTACAGTTGCGTAGGTGCTGAGGAGGGGTAAGGACACTAATGTGGCTTTTTGCTGAGCAGATTAATCGCCTTGTGG
ATATTcagaaggcgttggaggCTGCTAGAGGTGAACGTGTTCGTCTTAAAGAGCTGTGTGAGCTAGCCACCATCCACTGCCCTCTGGATGAATACTCCAT
CGACAAACTTGAGGAAGAATATGGAGAATCTCTAAGTGGACTATTCAAAGGTTCATCTCTTGAGGCAGCGACCACGGTACGAATGTTAACAGGCATGTCT
TGTGTAAAGGTTTTTGGCGGCGTCACCGTAATCCATATTTCTTACAGTATGTCCTTTTGCGCAGGCGGTGGTTGCTTCGGCTAAAGTGTTCAAGTTACAG
CAGCGAGCTTGTCATGTTTGGAGTGAAGCCGAGCGAGTTGAGCTGTTTCGAGCGACGTGTGCTGAATTGGCAAAAGGCGGACAACCGACTTCCAAAGAAA
AAGAGTTGCAGATACTTGGGAGGATCATGAGTTCGAGTCACCACAGTTGCCAAACACTGTACGAATGCAGTTGTCCCGAGCTGGATTCTCTTGTTACTAA
AGCCATGGTCGCCGGTGCTCTTGGAGCGCGCCTCACGGGTGCTGGCTGGGGCGGCTGCATCGTGGCACTTGTCTGGAAGACGAAGGTGTCTAGCTTCATG
GAAGCAATTCGATATAGCTACTATGAAGAACGAGGTATAACTCCAGCTGACACGCTATACGCGATGTTTGAGTCGTCCCCGGCGGATGGGGCCGACATTT
TCAGGGCTTGATCGCGTTGCCGCTTGTCTCGTTGCTGTAATTTCACGGAGACAGCAGTAGTGAACGAAGTTTCTCTAAGTACGCATCCTTTGCCTGTAGT
TCCACTTCAATGAGTGCCAACTGTTCCCACGCACAACAGACAGAAGACAATCATCAGACGATAATGCTTTTAAATAACTCAGGTTAATGCACGACCCACC
TCAGCATTGCGTTGGGCTTTCTCTGCGGGTGTCATcgcaaattgaagaatggTGAATTCGCTCTTTGATTTGAGGAAGAACTGGCGTCGGTCAGCTATCT
CTTGCTCGTAGGAATCGACCTCTTTCCGCATCTAAACCAGCATCAAGCAGAAGTAAGCATATTGGTTTGCAATTGAAGGACATACTTTCCCAAAACAAAT
ACCGTCATTTACCTCCATGGTAGCAGCGAAGCGTTCGAGTTCCAAAACGACGCTGAAGTATCCATCGTTCCTCTACAGGACGAtcacagcaaaacaaaaa
cagtAAGCATACACGACGGAGGATATACAAAATCCTTGGTAACTCACGTGAATCTTCTCGAAGGCCTTCTTTATCGCAGGCCGCGTCTGGACCCAACATG
GAGCAACCAAGGCAGCCTTTTTGCACGGGATCACACCAATCTCGACAGCATCCTGTTTACAACATATCAATGCGTCAGCGTACTAGACCAGCATGCAATT
GATCGAAGCAGTTGGATCACAAACCTTTGGCCGGAGGAATAGCACCTCATGATCGATCAGATCTAGGAACTTCTgctcgccttcttcacggtAATTAAAC
GGCAGCAGCGCATCAACGGAACTCGCGCAGTTGAGTGgcttcttgtctttcttctGATCCAACAGTTGCTGCGGCAGCCCGATGAGGGCATTGGCCCCTG
TTGCTGGAGTTACATCAGCCAACGTCTCAAAGCACTTCCATGTTTCCAATGCACTGAGCGCTTGGGACTCATTCGTTTGGTTCAGTGCACCCGTGTCTAC
CCCAGTTTGCATTCCACCTTGGAGCTGCAAACTGCCATCCAAACTCAGCACTTCGAGCAGATTTATCTCAGCGTCCTGCAAGAAAGAACCACAGACATCT
TGGATCACGGCTACCCGCTCTTCTCGGAGCGCCATCTCGTTCAGGTTACGGTCTTTTAGCCGGTGACAAATCGCGTCGAGGTCGCTCCACCAATTCCCAG
CTGTCTTTACAATTAGGtcgacgtcagcagcaataccaTTATCTTGCGCGCCGCCTGTAGAGCTAAACTTGTCAGCGGTGTCCGTGGCTGCTTTTTGTTC
CTCTGGAAACAGTTGTAGGCCATGTTCCTCCTGTAGCCACGCGATACACCATACAGATATTATGAAAATCTGCCCATCCAGAGTATGCATCAAGATTAAG
GAAACGTACCGATATTTTGCGCAACTTGTCTTCGGCTGAGGAAGTGTCAACGAGGCCATTCGCTGGGCGCAGCAAGATAGCCACGAAATTCTGTCCTGTA
TCTGAACTGGAGGCGCTCCAGCCGCGTTGATGACGCTCCTGAAGCCATTCGACTTTTGAAGGGGTCACCGTCGAGGTGGTAAGTAGAACCACATGAGCGA
AGCCGTTGCTTGTCACCTGGTAAGTCCAACGGAGCCATCTCTCGGCATTTTGGTCGTTAAGTGCATCAAAATCACGCAGGAAGAACacaggaactgcagc
aggttcaaCAGGAACATCACTAGGAGGTGAACCAGCTTCCGTCTCCTCACCTTTTGTTTCACCCCGCTCTTTTCCACTAGAATCAAGCTCTTGCAGCGCA
GTCAACACTgcctccatcatcttcgcttccGCGTTAGCTACGAGTCCGACACGAGGATCAAAGTCTGCAGGCACATCTCCATGCAGTGTCGTCTTCAACT
CTGAGTATCGCCTTGCAATCTTGTGAATTATTGATTCCAGAGCTGATGTGGGCTCAGTAAGCCTCTCCAGCGTTTCACGCGTTGCTTCTTCGTAAGATCC
TAGCACTCTCACACCTCCAAGCAAGCTGCCCATCAGACAGCTTGTTAATAACATATTATTCCAAATCCAATATTAATTAAGTCACGTACGTGTTCATTAC
AATACTGGGATCATCACCCTTGGATATAGATAGTAAATATGGGAATTTGGGCGGTGCAGTGCCCAACCAAGCGGAGGCGCCGCTGTCATTAGGCTCCAAG
TCACTGTTTGATGCTGTTTCAGAGCCTCTACGCCAATCCAGAAGTTGCCGTTTTGCGTACGCCACTTTATTGTTGTCGTCGTATTGCTGAGTGAATTCAC
CAGCTGCGATCACTGCTAGCGGCGTCAGTGTCGCGATGGCTGAACCGACGGAGCGAGCATTCCGCAGCATTTTGACGACCAATTGCGAATATACCTAGTT
ATACTTATACTAAATTGACATGTCAATTTAGTATACATTCAACTAATTCCTATCTTAATTCACGGTCATTTTTTCTTACCATACAAACGACTGGTTGGCA
GTGACTGACGTgttgcaagtgctggcaATGATGGCCATTCTTCATTTTTACATCAAACTATCATAGAAGGCATTGTTATCTATGTCTTGTTTCTTCTTTC
AATGGAGTGGCGTGTGATGTCTTTCATGCTGGGCGGGTTTCGGCCTGCTCAGAGTGAATTCCTCGTTTCTGACGAATCCGCTGAACAAGCGGCCTCAATG
AGACCAACCTAAGACTAAAACGACTGATGCTCTCCATCAATTCATTTTGCATTCTTACACCACGctaggtacatgtagtacgAATAGGCGAGAACATAGT
CTCGGTTCAgtatgttgttgctgttgagtGATTTGCCTACGAAAAGTGGTCATTTTTGGTGCCTAGTTCACCCGGGCCTGCCATCGCTAATGCAAAAGTC
AATGCCATTGCTGTACAAAAGCATGTCAATTGTCGTTACTACACCTACCTACAACAAGAATGTACTGCCTTCGCGCTCTGGCGAGTTGCTCTGGGCGATA
CGCTCACTTACCACCCTCTGTCGTGGTTAATAAATACCGAGCTTGCAGCTTCGTTTTCTCTCCAGTCTGCTTATTGGAGATGGCGCAGATGACCGTCAGC
GCCGAGTATGAACTCGGCGTCATCCTCACTTGGTCTGATGTTACTTCCACGCGGAGCTTCGAGCATTGAGATATTGTCGTCAGCTTGACGACGGAATGGC
GGCAGCATGGAGGAGCGTCCCGGCGATGGACTGCCGCTGTAGATTGTGGACACATCCGATGGGTTACGCTCGTCCATATCGAAGTCGTACTCGTCCAACG
ATGAAAGGCGGCCACCAAATAAACCATCACCACGGCGGCTGTCGCTCGGCAGGCCCACAATTGGACCAAAGCCTGAAGCATCCAGGTTTGGTGGGCTCAA
CTCGACAGCCGCACTGCTCCGGGCGCTTAACACACTGATGTTGTCGCCACCTGCATACGGAGATGTGAATTTGTAGAATTGCTCAttgtggtggtcgtgg
tACTCCTCACTCATGGCTTCGCTGCTGCGAGCAGAGAACCGGCCGCGGAACAAGTTCGTGATGCGCTGGCCCAGGAACGAGCTCGGGCGGTGATCTAAGT
CCGATGTACTGTCCCCACTTCTAAGTGATGAAAAGATGCTGTTTGTGTACTCCGAACCAGATATCGACGTCAGCGTCCCAAAGTCATTCGAGTATTTTGC
CATGTTGTCCAGGATCGTGTTCAGCGTCTCTGCGGCTTCTGGTGCAGAAGGACGATGCGACGGGTTTTGTGCCCAGCATTCCTCAATGAGCTGTGCGAAG
CGCTGTGGGCAACGCGAGCCAGGATTAATAGGTGGGCGTTGTTCCACAAGCACCTTCTCCCGCACTTCGAAGTCAAACTTGGTGTCGCTGAATGGCACAG
CGCCATCCGAGGCAATTTCCCACAGCACCATACCGAAAGAATACATGTCCGTGGCACGACTATACCGACAATTGTGCGGGTCCTGCAGAATCTCAGGTGC
ATTCCAACGCCATGTTCCAGCAAAAGACGTAAGTTCATCTGAAATGCTGGgattctgctgctctgtAAGGGTGACAGCACGCTCGCTGTATCGCACGCGG
TTAACCAGGTTGGCCACTTTGGAAATCCCGAAATCCGCGAGCTTGGCCTGCCACGTCTCGGTGACCAAAATATTGGACGCTTTGAGATCGCGGTGGATAT
ACGTCGGGTTCCGCGCGTGCAAGTAAGTTAGTCCCTTGGAAACGTgcaacgccagcgccactTTACGACGCCAATTGAGTGGGAAATGATTCTTGAGCAC
GTCCTTCAGACTTCCTCGCGCACAATACTCAGTAAGAATGCCCAGCTTGCCTTCGAAGTAGCCAGCGCGCATAAACAGCGTGATGTTTGGATGCCGCAAC
CGCGAGCACAACTGTGCTTCGGCGATGAAAGCTTCCTCCGAGTGCTGAATAATAGTGCGGTAGAGCTCTGCATCTATCACTCCTGCTGTGGCTGCGTTGG
GCAGCTTAACAACTTTCATGGCCACATCAATGCCTAGCCATTGCGCTTTGAACACGCtccctgcagctccttctgcaaTGAACGCCACGTTTGTGAGTCC
ATTCAGCTCCTCCAATCTCACGATTTCGTTCCCCACATACGTATTTTTCAGTGAGTCCTTTTCCCGCCCTTGACTATTTGAACTGCTAGCAAAAAGCGAC
CGGTACGATGATGCCAGCACGTTACCAACACCACTAACTGCATTGTTGTTGCCGCTACCTGCCAAGAGTCCAGTCCCCATGCGATCTCGTTGCCGTTCTC
CATGCCGCGAACTGTTGCTACTAGACTGTAACAACGTCCCATTTTCACCCGCATCACGAGTTTCTGGAAATCTCGCCTCCCCGAGATGCCGCCAGCCAAA
TACGAAGGTATTGAGCAGTGGCACGCAGAACAGCATGCAGTCGGCAATCTCGTACATAACGTACGACACCTTGTCGTGACCCACAAAATAGCACAGTAAT
ATGgggaactgcagcagttgaacCAACACAAAATAGCGCATGAGCTTCTCGTGTGCTACTCGCAAAGCTTGTTGAGCCTGCATTTCCCACGTCTTGCTGT
TCGCCAAAGTGGGATTGTCTGATCGAGCAAATCTATTGTCCACTGACGCGTTTGACGTCGTCGTTACTGTCGCCAAATTAGGCGCCAAGTCGTCCGAGAA
GTCTGCGCTGCGCCGTTGGATGAACAACATTACGTTGGCTGTAAGCACACTGCAGGCTGATATCGCGTAGACAGAGCCATAGAAATACCGGAGACAACTG
TTTAACTCGTCGAGTACCTCGTTTCCCTTGACCAGAGCTTGTAATCGCGCAGTCGACATCAGTCCGCCAGCGAGCCCTACGGTCCATATCACCAGCCAAC
TCACTTTCACTGGGAATCTTTTGAGCGGCGGCGTAGTCGCTGCAAGACCACGAGGTCGACGGTGCACTCGTATTACAAAGAACGATAGTGTAGCGCCCCA
CAACAAAGACGCCATGAAGCTCATTGCGAAGAGGGATTCGACACTGGCACCAATCACCGTGCGAATTTTCACACGTGAGCCCATGACCATGTCCATTGAC
TGGCTGATGGCGCCTGCACATGCGAATAACCAGTCGGTCATAACCACAGAGAAGTAGAGTGCTGGGCCAGTGGCGTGTGGCGGAGGAAGGGGTGGCTTCC
GATTCCGATTCCGATTCCGTCCACGTGTGCTGTAGCCTGGGTCTGGGATCCTTCGAAACATCACGACAGCCACGACGGACGAGATGACGGCCCCAGTGGA
AATTATCACGAGGCGCGTAGTCTCCAGCGCATGCTCCGCCGGAGTCATTGCCTTGTTGACGCTTTTGTTCCTGCTTAGCCCTGTTTGTATGTACACTGAA
TCGCCTAAGAAACGGTTGGAAATCAGTCAGTTCCTTGTTAAATTGAGCGGCCGTTTGTGAGGCGCCGTCCGCGTTGAAGCGGGCCCAAGACGTTGGCGAA
GTCCTATTGCTCTCGGAGCCGTTGCTTGCTGCCGGAAGGGAATGAGGACGATGCCCAGGCCCAGTTCACGAAGAAGACGAGTAGCTACCAGCTGTATAGT
TGCTCCGGCTCTACGCACATCTCCATCCCACCCCTTCCCGCAATGATACAACTAGCCAATCAAAGTCTCGCTGACTCGTACTCTCCTCTTTTATGATCGA
TATGACACCTTAGCCCATCGCCTCTTTTCGTACTCTACTAAGTACGATTAGTCACGCGCGTACCGATTCGTTGGTATGAATCGATCTACAATGAAATCTG
GTGCGCCATATAGATCCGCTCCACAAAGGGCAAACATCCAATCATACTGATCACATTCCCACTGTACCCATCACACGGTTTGGATTACTTGGTCAACAGC
TCACTACCAGATCTCCTCGCTTCAACTAACATCATGGAGACCATCGCTTGGACTACATACGTCGAGGCGTTGCGTTCAGGCGATCAGAGCGTCGATCAAG
TGGTGAAGCAACTTTGCAAGGACAATGACCTGACTGCAGACACGTCGGCCTCGTCTCAGACGACagctcaagttgctgcacttgtgctACAAGTGCTGAC
GAAACAGGTGCCTGCAACTGACGCGCACTATGTGGCGCctctgctggagcagcagctgaaagaGGACGCAAATATCGCCCACAGTCGCCACCAAGAGCGA
AGTGTTGCCGTTTCCCAACTGGTACAAGCTGCAATTTCTCAGAAGCTCCTGCACGACGACAGTCCGCTGACCAATCTCTTCAGCTGGGATGCTTTCCAGA
AGCGTCTCGATAACTTGCAGGCAGCCTTCCCTGAGCCAGAGTTTAATCATGCACTGGCTGTCAAGACCAACCCTACACGCGGTCTGCTGcgtggtggacg
agctgctggatgtggtgccGAGTGCGCTTCCATTGCTGAAGCCAAGCACTCGTTGTCGCTCGGGTTTGAACCCCGCAAAGTTGTGTATGATTCACCGTGT
AAGACATTAGGCGAGTTGCGTGAGATGATTCTGGCTGGAGTCTACATTAACGTGGACAATGAGGAAGAGATTCGGAAAGTGAACGAGATTTTCACCGAGT
TAGGGTCGTCTGAAGagacgatgaagcagcacgCGTCGCAGATTGGACTACGTATCAACCCGGTGGTTGGAGGAGGCACGATTGATGCCACCAGCACGGC
GACAGTGACCAGCAAATTTGGACTTGCACTTACTGCGGAGACGAAGCCACGACTGCTGGCGATTTACAAACAGAACCCGTGGCTGCAAGGTATGCACGTT
CATGTAGGCTCCCAGGGTTGCCCTCTGGACCTATTGGCGGCAGGTGCCAAAAAGGCTGTAGCCTTCGCACTTGAGGTCAACGCCCATGTGGGTAAAATGC
AAGTGTGTGTGcttgacattggaggcggCATGCCCACTGTGTACGACGGCGGAGAACGCGAGGCTTATGACTTCAAAGAGTATGCGGACTCTGTGCGCGA
GCAGGTGCCCGAGCTCTTTACTAGCGGGTTCTCCTCCATTATCACAGAGTTCGGACGCAGTATCTTCGTCAAGCCAGGTATCACGGTGTCCAAGGTGGAG
GCCGTGAAAGACTGGGCAGGACAGCATATTGCTGTGGTGCACGTAGGAGCCGACCAGTTCCCACGGACAGCATATCTACCAGAGCTGTGGTCACACTGTA
TCAGTGTGCTGGACAGCCAAGGACGTCCGAAAACGGACCCTAGTAGTGCCTACCTGCGTCAAGATATCGCCGGACCACTCTGCTTTTCGGGCGACTTCCT
CGCTAAACAGGTATTGCTGCCGCCCATCCAAGTAGGTGACTTCGTGGTGATCCACGATACCGGGGGATATACCATGTCGATGCACTCCAAGTACAACAGC
CGACAAGTGTCGTCACATTATGCTTATTCGGGCTCTTCTAACACCATCAAG