Description :
From Genome Similarity Track
Location :
Scaffold_367:3174- 10720
Transcript NameFunction/comments
Phyta_totarag7601hypothetical protein PHYSODRAFT_482402
Phyta_totarag7602hypothetical protein

Sequence
7546 bases(100 bases per row)
GAAACCGCCCGCAAGTAAGCAAGCAACTCAGGTGGTCCGACGGATGGATCCCGGTGGGTAGTCGATgacgctcagcagcgctggtTGGTTTCTGCCGAGT
GCCAGTCGCCAGCACGGCAAACTCGGGGCGTTTGAGCCCGTCGCTCTATCACAGTTTTAGGCGTTCGCAATGGCGCCGAGCGCTGGTCGGAATTTCCGAC
GTCTCGCCCGGGCGGGAAAGGCACCTGTTGGCGCAGACGCGGCAAGAAATAGGGCACGCTGCCCTTTATAAGACCCGCGTCCCGGCTTTCGCAGTCAGCT
TGGAGCCACGAACCCGCTCGCTCCGAATGGCGACCGGCACTGCTGACAGCTTGTCGCGCGGGCCCAGCGGTCACCGCCGCGGTGGGTGTGCTGGCCGACC
TCGTTATCCAACGACGCGTCAGCTCGTTTTACACAACTCGCTGTGGCACTGACTTGGCGACTGGGCTGCGGGTCTCCTCATTATTGGAGACCAAATTGCG
GAGACCTCGGTAGGCACTGTAGTCTGATATCTTCAGTTGTTCGCCGCGTTTACGCTTGTGAAACTGAAGTTTGGAATGGCGACGCCGAGGAAGCCTCGTC
GCGTGCCAACTTGCACTGTTCAGGCGGGCTGGGGTGAAAGCAGGCGCAATCGAGTCGTTTGCGCTGTCGACTCGATCGTGTCGAGAGCGCCGACACGAGA
CGGAGCAAGGCTCCGCTGCCAGTCAAGTGCTTTGCCCTGCAAGGAAAGAGAAGGGCTCAGAAAAAACTGTTTTCTTTGAAAAAGTACTGACGGCGGGGAT
GGACGCGGCTATCATCAGCATTGCATCGCAGGTGCTTACCaaagcagcaagatgaagtgCATTTTGCCTTCAAATGGGCGGGATGGGCGGACCGGCTTTG
GTAGGTGTCCACCCTTTAGGGTGGGATTACGGCCAAAATGCGTTGGAAAAAGCGTTTTTTTTGCATATCAAGGCATCCGATTGGCCTAGCTGGCTTTCCG
ATTGCGCACACTTCAAAGTATCCTCGAGGCTGTGGACGAGCTGTGGACGAAGCGCTAGCCGCCACCAGGGCAAGCTACTGCAACGAGCCGCCCTCGTTGG
CAATGCAGTCCTGCTGTATCACGATTTTTGTCGCGCGGCTAAGTTCCGTCCAAAGGCTGCGCAGTGCGATGAGTCACCACCGGAATGGggcgtcgtgcag
catttgGTTGCTAGCATTTGGTCGCTTCGATTCCGGAGGTTCGGCCAGACGTGTAGAATCAACTTGGCGCCGTAATAACACCATCGTGGCAAGCAGGCCG
GCGTTTTACAACCTTAGAGCGGCTAGAACTTTTAATAAGAGGTGGAGACACTTCCGTAGAAGTGATCTAGCGTCTGAGGTTCTCTGTTCGTCAAGCAGTG
CTCGGGCAGCACCAGATAAGCCGACTGGTTTGCTGGTGCCCTGCTTGGCCAACAGAGCTCGCTCcagcggcgctgctggtgatgcgAAAACTGGTTGTGT
GAAACCGCTTTCGCAGTGTAGCTGCAAAAGCGTATCGTGATACCAGAATTGACACTAAAAGCCTCATATTGTCCATGTATCCCCTTTTGAAAGCCACGGA
AGAGTATTACTCCTGCAGTAATACTATATTTGGCAAGGTCTTCGGCTCAAACAAACTCTTCCCGCCGAAGAGGGACGACGCAATAGAAGCTGCCGGTGAT
GAGGAATGAGCTGGGAGTTCTGGAGATGACGAGCTTATCGCGATCGAATCTGCTGCATTTATCATCTTCGGTTTTATCAAAATTTTAGTTCTACGGCGTT
ATGGCGGTTGGGTGATACGAGTCGTATCATACGACCGATGCGAGTTGGCCGCAACGTGCCACTGGTGGACTTCTTGTCAAGCTGGCATAGGCTACAGAGG
ATCAAGCTCGGTGAACACATATTAGGCTCGACTTACCAGGTGAGTTTATGCAGTGCCCCGACAAGTAGGTAGGGCCCTTCCGCCTTCTGTAGCGACGGAG
AAGCTAACATTGTATTAGCTGGTGTGGCGGTGGTGAAGCCACAGAGCTGCGATTGTGTGGTCTTCCGCTTTGACAGCAACCAGCCGCTGTTCCTGCGATA
CACTCCAGCCGTCTCTGCCATCTGCAAATATTGTGCCGAGAATTGAGTACAGAACATACTGGTACACACGGCTGCAAGTCTAGCCATCCATCTGGTGGCT
CGGAGTTCTTCAAGCGAGAGCCTCTTGCAAGAGTCTATCCCAGTTCGTCGCCTTCTGTcgcatttgctgctgtctacCGCGTGCCAGCTGAACTTGCAGG
CCCTGGTCGCTGATTCAATCCATTTCGCCATCCCAGCTTGCAAGTAGAGACGGCGTTTTCCGTGTAGCGAAAGGAGACTTATTAAAATACTGTACTAGCA
GTCGACGTTCcctgcagcaagcaaacaTGGCGTCGCCGGTGCATTTATCGCGCGACCGCGCGCAGACTCGCAGGATGCACCACCGCGCCATGAGGCAAAT
CACGGACGTGCTGGGTGTGTGTCTCAACTCGACACGCGCGAAGGAGCAGTGGACATGTTTGCGTCGCGACAAGCACCAGGAACTGTACGCCAAGCGTACC
GACCAAGGAGTGACCAACGGGTCCTCCGTTTATTATTTAGCAGTGAACGAGGCTTCTTGCGGCTTTGAGGAAGCCTTTGATCTGCTTCACTTTGACTCGA
CTGCTCAATTCCGACTCATGATGAAGCTCCTGCACGGTCGCGACTTCAAAGATGGCGCTTTGCTGTCCATGCGCACAAAAGAACACTCGCTTGGTGACTG
GGCCATGGACACCCAGCACGCAGCAGTTTGGTTCATCTATCAGGATCACCGCAAGTCGGTACTGCTGCGTGAACAGCACCTGACTTTTTTCCAGACGCTC
AAGATTTTTCTACcagacaaccagcagcaccaagagcaCGACTACCACAATGCCGTTGCATCCATGTCGGCAACCTCGTCAATGGCAGGGTTGAGTGCGC
GTCCATACGATGGTGTGCACAAGCGGACCATAGCGCTAAGCTGGCTGCCGTTTACTCGTTCGCACGAGGCGATGCTGGAAACGGCGCAGCAGGTCGATCT
GCAGTACACGTTGATTGTGGAGGAGATTTCTCCTAATCGGCTGCGTCTGTCGTGTGTCACCAGCTCCTTTCATGACGAAAACGAAGGCCCTCTGGCCGGT
TCGCCCTGGGCAGCACGAGCCATTGCACGGCGACTAGCTTCGCGATCCGTTGGGAAACTGGAGTCGGCCGTGGCAGCATCCAGAATCGGGGATTGCCAAT
TGGTAGCTCCACACCAATGGGTGAAGAATGAGGACCGGGCAAGCTGTGTGATCTGCTGGAAACGCTTCAACGCTATCTTTCGTCGCCGTCATCACTGTCG
TCTCTGCGGAGAAGTCATTTgcggctcctgctgctcactgCGCACCATTAACATTGTCAACGTGAAAACGAAGGAGGTTCAGAAGACTCGAATCTGTCAT
CtctgcaacaacaaggcTCGACTCAAGACCAGTCCGCAAACCTTTTCCAGCAACAACTATAACAGCAGAGCTCCACCTTCTAGCCAACGATGGGAACAAC
CCCCTCTGCTTGAGTCGGAGTCGGACTCCGAGTTTCCTCTCTCTTTACGAGTGCTTCCGGCAAATTTGAAAGTAGTGGCGAGTCCAGACTTCATactgcc
accaccttcagTAGAGCTCACGCTATCGCTAAGGGCTACGAACTTTGAAGGAAGTGACCGCACCAACGACTTCGAAGATGCTGAGAGCGATGGCTACATT
GGTGCACTACCCGATCGACTGGCAGCCACCGTCAGTAGCAAGATCATCTCCATCAAGTCCATCGCACGTAGCACCAAAAATTTCTGGCAGGCGATGCCCT
CCACTACGTCAAGCATCAAGAGTCTATGGTCACTCCAAGCGCTCGACTCAAACAGCGTCGAATCTAGTGTGAATTCCTCTGGCTGGGCTGGAGGAGGTAA
CAGCGGTGAATTTGAGGCCCCGCGATCTGGGTTTAACGCCTCGAGGTCGTTCCTACACCCGGCAGCCATGGTGTCTAGGTCGCGAAGGATGGCTCAGCCG
ATTCGCATCACGGCAGACtcaagcagctacagctcTGCTGATCGCTCTTTCCTTTCGTCGTACGGCGCAGTTTACTCGAAGGAGCGAGAGGAGGAAGACT
TGAGGAGATTTGATCATCGGCGAACGTCTTTGATGAGCTCCAATGTCGGTCTTCTTGACCAGGATTCGATCGCTGACGAGGGCTATTTCTTACCCAAATT
GGATGGAgatcgcgaagaagagcgactgAAGCTCCTGGAAGTAATCATATCACCTGCATGTACGCTAGTTGATCGCACCATCATGCACCGAAGCTGCGAG
AtcgcagccgcagccttTGGTGTGACCGCCGCCTTCGTTGCGCGGGTGGACGAGGAGTACGTGCTGATTGAGCATGCCATCGGGACTTGCGATCTATCAC
CACAGGATGAGATCTTGCGGCGTGAGTCATTGTGCGATTTTGTACTCTGTCAGCCTCAGTACCAACCTTTAGTAGTGATAGATTGCCTCGCTGACCCACG
GACACGAGATATTCCTATGGTGCAGCATCTGCGcatgcgcttcttcatcggtATTAGCGTGTGCGTGAGTGGTCTTCCCATCGCGTGCCTGTGCGCATTT
GGACAAGACGGTGACAACCaaagcgaggaggaagatggaACAATGGCGGCGTCATACTACGATTTGGGCATCCTAGAAAACGCGGCACATCGCATGGAGG
ACGAGTTGGAAAGTCTTGTCCATGGCTTGGAGTTGTGCTAGACACCGTAAAGACCAACCACATGTAGTCTCTCTAAATGGGTTCATCTCGCGGCTCTACC
AGAATCTCGTTCACGGCCACGTATGGCGGCTGCGTGACAGCGTACAGCACGGTGCGACCGATATCCTCTGGCTTGAGGACCTCACACTCTGTTGTAGAGT
ATTTAGCGGTGGTATACGTACAACATTAGAGACCGCACAGCAACAAATAAGAACGCAGCTTGCACCACGAGATCTTACCGGAAGGTCCTCcgtacagctt
catcgcCTCTTCATCCACACCACTGGCAGCATTCGCGTGCTTGACTAGGTCCGTAGCGACGTTGCCAGGCTGGAAACAGTAGTGCAGTCAAACAGCCATG
AGTCTGTAGCTTCCATCAACACCCTGCTGCAACAGAATAGTGTACCTGAATGGAGGTCACGCGCAAGCCACTGCCGACGTTTTCAAGGCGCAGTGCCTGT
GAGATGCCCTCAACAAACATCTTGGATGCCGAATAAACACCCAACCCGGGGAAAATCTTGCGGCCAGCGTCCGACGAGATGTTGACAATGTGGCCGCTCT
TCCGAGCCAACATCTTGGGCAGCACGGCAGCCACACCATTAAGTGTCCCCTTGCAGTTGATGTCGATCGTCTGCAGAGCACCAAACACGCCATTCCGAAT
CAGAATTTCCAGGAGAATGACCGACATCTCAGCTCGGCCAACTCAGCTCACCCGGTCCCAACTGTCCTGGTTCACGTTCTTCAGGAGCTCAAAGGGCATT
ACACCAGCTGCAATCAACACAGAAAACAATAATAAAAAACTCACCGTTAGAGCAAAATCTCAGTAAAGTAAATGGTCTTCCTCACCATTGTTCACAAGGA
TGTCTATAGCCCCGAAAGCCTCTTCCGCCTTGTTCACGAGGTTCTGCACCTCCTGGCGCTTGGTGACGTCCGTCtggacgatgaggacgccGCCGTTGGC
TCCGATCTTCTGCTCGATGCTCGTCTTGACAGTCTCCAGAGCCTCGAGGCGTCGGGCCCCAAGTGCCACCTTCGCACCCGCCGCTgtcagctccagcgcg
aTGGCTGCGGAATTTAACAAGGAGACATTGAGAATAGCGAGGAAAGGTGTGAGTGGGGCTGCATGAAGGCTACGCACCGGCGCCGATTCCTCCCGAGGCG
CCTGTGATCACTGCCACTTTGCCACTCAACTGCGTGTTGCTACTCATCGTCGAAAATGATCCCCCAGGTTGATCGCTCTTGTTACCGGTATACCGGGTAT
TTTCCACCAGGTTGAagtgttgaagctgtacTGGCATTCCAGCACCAGAGTTTATCTTCTAAATGGACCTATCGCGCGGCTGTACCAAGACTTCGTTCAC
GGCCACGTACAGCGGTTGAGTGATGGCATACAGCACGGCGCGACTGACGTCTTCAGACTGAAGCTCTTCGCACTCTGTAATTTTGTGGAGGAAAAGTTAg
atatgtacatgtacaacatcCAATATGTAAATAGTGATGGAAGAAGCAGCCTTACCTGGCTCCTCCTCGAACATCCTGGTAGCTTCTTCGTCCCTGCCGC
TGACGGCGTTCGCGTGATCCACCAAAAACGTTGTGACGTCTCCAGGCTGCAATCGACAATAATCAAATCGTGTCAACAATTGCTTGATCTTCCCTCCGCG
ATGCTCCATGGCAACTACACAAGCTCCGACTTACCTGGATAGAGGTCACGCGCAAGCCGCTACCAACATTCTCAAGACGCAGAGCCTGCGATATTCCTTC
AACGAACATCTTGGACGCTGAGTAGACGCCCAGTCCAGCAAAAACCTTACGTCCAGCGTCCGAGGAAATGTTGACGATGTGGCCACTCTTGCGAGTCAGC
ATCTTGGGCAGTACTGCAGCCACTCCGTTCAGCGTGCCTTTGCAGTTGATGTCGATCATCTGCCACCAGCAAAGATCTTCAGTCTCACAATATTCCTCCT
GTTAACCGCATACCAGCATACATACAACATCAAACTGAAGCCCACCCGGTCCCAACTGTCCTGGTCCACGTTCTTCATGAGCTGAACGTGCATCACACCA
GCTGCACCCGACGCCACAGCAAAAAGACCACAGCATGAGTCCCAGCAACACATAATTCCCTccaacaccaccaccacagcatTAAAACCAGGAGAATTTA
TCCGCTCACCGTTGTTGACGAGGATGTCCACCGGCCCGAAGGTCTCTTCCGTCTTGTCCACGAGGTTTTGCATCTGCCCATACCTCAGTCAGTTTTCTCT
CTTCTTCCACCTCCAAATGCTTATTCTAATCACCTGCTCACGGCTAGTGACATCCGTTTCAACGACCAGAACATTTCCACTCGCTCCGATCTTCGCCTCG
ATGCCCGTCTTGACGTTCTCCAGAGCCTCcagtcgacgagctccaATCGCCACCTTGGCACCCGCTTTCGCCAGATTCAACGCGATCGCTAAAGCAAATT
AACAGTGATAAATCAGTCACCAGTAAGATAAATCTGAGTAAGGGTGATAGAAGTCCACACACCGGCGCCAATGCCTCCCGAGGCGCCCGtgaccaccgcc
accttGCCACTCAACGGCATGCTACTCATCGCTGTCAAAATGATATTCGCACTTAAGACGTACTTAACGGTAAAATACCGGTTTTCATTCCGATACACCA
GTTATTTCACTAGGTGTGTTAAGTTCGTTTGACGTCCACAATTCCA