Description :
From Genome Similarity Track
Location :
contig_47:317398- 321079
Transcript NameFunction/comments
g9245.t1hypothetical protein

Sequence
3681 bases(100 bases per row)
ATGTCGACCAAAATGCTGCAGGGAGACCCGCGACGTCCGGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCCCCAGGCGACTGGT
ACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCGTTCACCATGAAGGTGCGTCACAATCCCGCCCAACTTGCTTTTGGGAGTCTTATTTGGGCTAATAT
TTGTGTACCTTTTTCCAGTGGAAGGAGCTGGCGTGGGGTTCGCTGCTGCTGTGTGTGGGCTCATTCACCAACATGAAGTCGCAGGACATGAACACGACGC
AGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCCCTCGTGTCCGCCTACATGGGCAATATGCGTCCAGGAATGCCCATGTCGTCGGCCCAGACGGCGGA
TGCCCCCGCTTCGTAGAAAGAGGGAGATGTAGGTATCCATCAGGGGGAGAGTGCTGTAAGAATGGAAAGAACCGAACTGTTTGATGGTGTTTTTGCTTTT
TGCTACAGCTCTGAAGGATGAGGGTAACGACTGCTGCTATTTCTGAGGACTAACGGAGTGTCATGATTCCTGCGACTGTTGCTGCCAGAAAATGACGATT
GGTCTGCGCGAGGTTAGTCCTGAGAGTTTTGGAGAGGAAGCAGCTCGGACGAAGGATCCCCCTCGTGGAGATGGGTACCAGCATGCTGGTCAAGAAGCTG
GCAGTGGTCAGCCCCAGAAGATGATGAAGCGGCCGCGAGGACCGCCGCCAGCCAAGATACCCATGACGTCGACTACCCCAGCAGCTCGGTTTTTGCCACC
TATTAGGCCAGCAAGTCCTAGCACCCTTGGCCCAGCTTCTTTGATGATGACTCTGGAGGAAAAACAGCAGCGACAGATGCACTCGTTCCTGCGCAACTTT
CTCGATCCAGGTGAAAGTGGTCGTTTCCAGCAAGTAATTGACCTCCATCAGCATGGAATTGACACGGGCATTACTGTCACTGACGCGACGCTACAGGAAG
TGGTGCTCACTGTGCCGAATCTCCGCGGGCTGAATCTATCCGGCTGCTGTCACATCACTGATGCGGGGCTTTGGGCCGTGGCCAGACACTGCCAAGCCCA
GCTAGATACTATCTACCTGGCTCAGTGCGAGCGAGTGACAGAGCTCGGGCTGCGTCTTCTCGCTCATAACTGCAGACTTGTGCTGGTGGACCTCAGTGAC
TGCCCGCAGCTCAATGATGCCGCGTTGCAAACGTTAGCCGCTGGCTGCTGGATGATTGAGACTTTCATAATGAAGCGGTGTCGAGGTGTTTCCGACGCCG
GTATCGTCAAAATTGCTCAGTGCTGCAAAGACTTGCGCCATTTGGATGTGTCTGAGTGTTCTCGGCTCGGTGAATACGGCGACAAAGCGCTCCTTGAAAT
CGGAAAGTGCTGCCCGAAGTTACTTGTGCTGGATCTCTTCGGCTGCCAGCACGTGCATGACCCTGGAGTTCGCGCTATCGCGAAAGGCTGCCCATTATTA
ACGACACTCAAACTCACTGGATGTCGGGATGTCAGCAGCATAGCCATCCGGGCATTAGCTCAGCAGTGCACACAGCTCGAGGTCCTCTCACTCTCAGGGT
GCATCAAAACGACGAATAGTGACCTTCAGCTCCTTGCGACTAACTGCCCGCAACTCACCTGGCTAGACATCAGCGGCAGCCCGAATATTGACGCGCGAGG
TGTACGCGCATTGGCACAGAACTGCACTTCTTTGACGTATCTCAGCCTGGCTCTGTGTCAACGCGTTGGGGATGCGGCATTGGGCGAGCTTGCCAGTGCA
GGAACTGGAGGTCTCGCCAAGTCTCTAGCGGAGTTGTCGTTAGCAGAGTGCCCTCGCGTCACGGAAAACGGCGTCAACGCACTTACTGCCGTGTGCACCA
ACCTTATCACTCTAAATCTCACCAACTGCAGACAAATCGGCCGAAGGTTCCTTCAGAGACTTATTAACAAGCTTGAATTCGTGCAATGGGCCACCAGTTT
CTTCGGCTACGAGCCGTTGCCGAATGCCGCAGAGCTGTGCCGTCAGCGCGACCTCCGTTTGTTGCAGCTTCGGAGTGCCATCAAAATCCAGTCGGCGATA
CGTGGATGCCTTGCACGTGGTGGACTTTGGCAAGCGAAACTCAAATTTGTGGAGCGAAAAATTCTACCCAAGATCCAAGCGCGTGTGCGAGGGTTCTTGC
TAAGGAAGAGCTTGGCAGCGGAAAAGCAGTATCAACTAGAGGAGCATGCTGCTCGCTCAATTGGGCGTGCATATCGCGACTTGCAGCTTCGACGCATGTT
GGTGCGTGCGAAGCGCTTGCGGCAAATCAAGGAGCATGAAGATGAGGCTGCTCTCATTTTCCAGAAGATTTTCCGAGGGTATCGTGACCGAAAACTTTTG
GCCAAGATGAGGTATGATATCTACTGCGAGCAGCAACTCCAAGCTCGTGTTCTGGTGATGCGAAATTTGGCAGCCACAAAGTTGCAACGTGCGTACCGAG
GACATCGCGGGCGGTCCGATGTTGCCATGTTGCGCTCAATCAAGGAAGCAAAGCGTCTTCAGCACGAGAAAGAAATTCGCTCAGCATCTTTTATCCAACG
TGTATATCGAGGCCACAAAGGACGCACGGTTCGTGCTCAGCGCCTTGCAGAATTACTTCATCAGCAACAATGCGACCAAGGAGCCATCAAAATGCAAAAG
GTGTTCCGTGGCCATCGAGCACGACGGAATGCAGTACTGTTGCGTACTGAAGCGAGTGAGTTACGGATACTTAACGCCGCCTTGACTATTCAAAGATACT
GGCGAGGAATCCGCGATAAGCATTTGGCCGCGGTGTTGATTGGGTTAGTCAAGCTGCGTGCCAGGGAAAACGAGGCTGCCTACTCGATCCAAGCTGCTTA
TCGTATACATGCCTCCCGAGGATTCATGAAGGCGATGAAGCTGGCTTTGGCAGCGCAGCTGAGAAGAGTGAAAGCAGCTACCGATATTCAACGTCTCACA
CGTGGACATCGTGGACGGGCAGAGGCTGAGCTTCGGAGGGAGTTGCAACGATTCCGTCACCAAGCTAAACCGTTATTCGCGAAAGAAGCACGTTTACAAG
CACTTGTGCATGACCTGAACGAGAAAGTGGAACAGCTACAACGTAAACTCACTGCTGATGAAGAAGAAGAGCGTGCTCTCACGCTTGAACTCGAGAAAAC
GCTACAGATCAGAACAAAGTACCATGACTCGAGTCGTATCACGGGCACACCCCAACGCTATCTGACGCAGTATCTGCAAGTACAGCTTGCCGATCAGCTA
CGGGCAAAGCGAACTGAGATCGCCCTTGATGAACGGGCTTTTGAAACCTTAACGACAAATCTGAATGACGCTCAAAAGCAATTGCGGGGCGTTAGGCGGG
AGCTGGAGCCGCTAACGGAAGGTGTTATCAAGAAAACACGTGAAAACCGCGTGAAGAGGTTGCAGGATAAAGTTCGCCATGAACGTCGAGCGGCAACTAC
TATCCAAAAGGTCTTTCGTGGCTTTCGCGTGAGGTCAGCGGTTCGAGAAGGTGGAAATTGCTGGACGCAAATGGTTTCACCTGACAATGCGCGACCATAT
TTCTATAATGCACTGACAGGAGCGACAAGGTGGCATCGTCCTTTAGCAATGGACATCTTCGGAGGCCAACTTGCAGAGCCC