Description :
From Genome Similarity Track
Location :
scaffold_38:317361- 331268
Transcript NameFunction/comments
g12737.t1 hypothetical protein PHYSODRAFT_468947
g12738.t1 hypothetical protein PHYSODRAFT_293792
g12739.t1 hypothetical protein PHYSODRAFT_343752
g12740.t1 hypothetical protein PHYSODRAFT_309106
g12741.t1 hypothetical protein PHYSODRAFT_248374
g12742.t1hypothetical protein
g12743.t1 60S ribosomal protein L17-2

Sequence
13907 bases(100 bases per row)
GACACCAAAGGCGCCTTGCTGGTCCGCAGGAGGGAGCTTCGTCGGGTACGGGATCTCGGGCTTCTTGTAGGCCTCAAAATTCAAGCGGTTCGAGTCACCG
CCATTGCGACGGTGGCCGTAACCTTCATCCTCGTCGTCCGAGTCCTCGGGAGGGTCGTAGAGCGGTGCTCCTTGAGCCGCTGCCTTTTCGACAAAACTGG
TAAGGAAAGAAAGGTTGGGATCAACATCAATGTCCTCGCAGCTTGCATCTTCCGGGAAGACCTCATTCATAAGGGAGAAGTTCTTGGTAAGAGCAAGGTA
CTCAAAGCAGCGCTGCTGCAGGTCCGTGCTACGACTGGTCTTGTACTTATCCATCATGGCGTCGGCCATATCGATAGTGTGCCCCATCTGCGCCGTGATC
TTGGTCACGGCTGAAAGCACGTAGCCACGAGTAGTGTCTTCCTGGTCGAATGGACGGTCAACAAGCTCCACAAGCCGCTCGCAGATCTCTTCCAGCTCCA
TAGCGTCCGACAGGTAGCCGTACTCACCAAGGACCCAGGCCATCGTGCACACCAGAATGTCCGGCAGCACAGGGCGCTCCAACAGCTCCAGGTAAGTGTC
GACAGCATCACGACGAAGCTCCATGTCCTGGTCTTCATCTTCTCCACTTCCCTCGGCAATCAGACGCAGCAAGTTGTGCGCCACCTCGGGACGAACAAGG
TCACCGCCCAGTTCGAACACATTTGTCATGGTCTGAATGTACCATGCGTTGCTGGGCGCATAACGCTCGGCGCACTGCGTAATACGGGACACAAGTTCCG
TACGCAGGAAGACGTCCGAAGCTTCGCGAAGGAACTGCGTGAGCTTGTCCGAAATGAACTCAACATTCACGGGGTTCGTCATGCGGTACAGCAGATCCAG
CGTCTTGCGCTTTAGCGTCTCATCCGGGTCCTCTAAACAGTCAATGACAGCCATTTGGTGTGCTGCAGCGTATCGAGGGTGGTCCTTAACGATGGCAGCA
AGTCCTGTGACACCCAAGTACTTCAGGTTGTGGTTATCGCTCGAGATGAAGCGCGAAATGCTAGCAGCCGCGGCATCCAGCAGTGTGCTGTTCGGGTAGA
TGGTAGTCACCGTCTGCACGCACTCGTAGATGATAGCGTAGCCCACATTGATCCCAGTGTCAGCACGACGCATGACATCGTGCAGCACCTCGTACATTCC
TTCACTGGTCTGCTGGTCAGCCTGGCCCAACAGCGCCAGGATCTTCAGCAAACGAATCTGGATCCAGGGGGCCGGGATGCGATGGTAGTCGAACTCACGA
GGCAGACGGTGCTCCGTGATCTGCTTGAGAATACTCACAAAGCTGGGCACGAGGTCCTTGTAGTCCGTGGGGATGGCCTCCGCCAGGTCGTGCAAGATGC
AGAGCGTAGTTCCCATGACACTGGGGTCGCGGTCACACAATGTGCGACGCAGCGCGTCTCCAACGTCGCTGACCGAGTCCGGGTTGAGCTGGTGGAAGCG
ATGGATGGCCATGACGGCCTTCTTGCGCACGAGCTCGGCGTCGTGGCGCAGCAGGTCGAGGATCATGGGTTGCACGGCCGGCACCATCTCCACCGTCACG
AGCTTGCAAACGGCCATGAGCGCCGCGCAGACCTCAAGGTGGTTGGAGCTCTGCAGGTCTCTCTGCAGCTGGTTGATGATCATGAAGCGGAACTCGTGCG
TGGGCGACAGACACAGGCTGCACGTAAGGTAGCCCACGCGCTTCTGCATGAGGTTGGTGCTGGCAGTCATCTCCACCGCCTTGATGTAGCCGAAGGACGC
GTCGTGGCCCAGCATCTCCACGTACATGAGGCGAATGAGGAACTCGCGCTTGCGCTTGTTCACAAGGCTGCTGGACGTGCTGGACGACGCCGTCACCTCG
TTCAGCTTGCGCTTGAGCTGCGCCACCTCATGGATGATGATGCGGTCCTCCTCTTGCTTCGACTTGCTCTCGCCGATCGACTTGACCAGCTCGAAGAACT
CCTTGGATAGGTGCCCGCCCGACATGGCGCGAAGCTGACGTGGACAGCGGCGAGATCGCGGATTGAGGGGGTGTCGGCACCGCGCCACGTAGTGTGGTTG
TGTTGGCTATCCGACCAATACGATTTATTTATATACGGGTTTTTAAATAAAATGCAATAAATATTGGCTTTGCAAAAGTAAATCTTTGTAATGGTCGGAT
AGATGCGTAGTTTACGATCGCCCTATGGTGTGGCATATTCCGTCGAGTGGCATATTGTGAGCTCATAAAGTGACGATGGACGGCGTGGAGCTCTCGGACG
GAGTGCTGCGCTCCTACAGCGTCGCACGAAACTTCGTTCCGCAGGTAGGACGTCGGTCTGCCAATAGCTGCTACTATTTGCTGGTGCGTACCGTTATACT
GAGAGTGTTGTCAACTGCGCAGGAGGACGAAGATACGAATGGGCAGATCACGTCCCTAGATTTCCATCGCAGTGGCGAGCGGTGCGTTACGAGTCGCAGC
GACGGCGTCCTGTCCATGATCAACTGCTTGAGTGGAACGTGAGTTGCATTACGCGGTGCTCTCGTATTGCTGTCGACTAGACCAGGTGAGCGTAGCTGAC
ACCTTGCTATGCTCTCCACAGAGTCGCCAAAACGATTTTGACCAAGCGATACGGCGTCGGCATCGTGCGGTTCACCCACCACCCGGACTGCGTGATCTTC
TCTTCGGCTAACAATGCCAACGATCGTACGCTGCTGCGGTAGTGACTAACTGGAAGGTGTGTGTGTATCCTTGACAGCGTTGATGTTTGTGTTTGAGCAG
ACCGCATTCGGTACCACTCGTTCTTCGACAATAAGTTCCTCCGCTATTACACTGGTCATACCGACAGGTAGCTTGAACCTCTTAAGCGCCAAGCTGCTTA
TTTAGTTGGGAGTTAATGCTCATTCGGTCGTTGCATGCTCCCAGAGTCACATCGCTGATGATGCACCCCACCGCAGACCAGTTCATTTCCGCTGGAATGG
ATGGCACGATTCGACTGTGGGATATCCGTAACTCAGACACCTCGGTGCGTCGCAGTCTGTGAGTGCCCTTATTTGCGGCATTTATCTAACCGATATTGTT
TTGCTGTGTAAAGGCTATCATTCGAACCGATCACTTGCCAGTCTCGCATATCTGCGCTGCGTATGACCAGGAGGGTGTGGTGTTTGGTGTATACACGGAC
GATCACTTGATCCGGATGTACGATGCGAGGAATTACCAGGAAGGACCCTTCGCCAAGTTCTCGCTCTATGACGCGTCGGTCATGGCAGCCGTGGAGCCGT
TCCTCGCGCAGATGCAGGCGCCGAGCTTGAATGTCAAGAAGCTGCACGCACTCGACATGAAATTCAGTCCCGATGGTAACCAGTTGCTCGTTACAACCAA
CCGCGGAGTGTTCATCCACCTCGATGCGTTTGAGGGCAAACTGCTGCATCTCTTCAAGGAGCATGGCTTGACTCAGAGTCAGCGCAGCGAACCCCAGCTC
GGTTGTTGCTACTCGGCCGATGGCGCGTATGTGGCCACGGGAGCGGAAGACGGCAGGGTGTTCTTCTACAAGAGTTCTACCGGTCAATTCATGCACACAC
TCCCGCAGGGCCACAATGGGCCCGTGGTCGATTTGCAGTGGAACCCAAAGCGCCACCTTCTAGCAAGTGGTGGAGGCAACTCGACAGTGTTGTGGTCGGC
GGCTGGGGTATGAGGACTACCGTGCCGCAACAATAAACTTGCAAGTTTTTAAATTTTGCTACAATTCATGTCCTTGCCAACACTCTGCCGCTACTGCTGA
GAACTTAAGTTCTTCCCAGCCGTTGCATCACTTCGGTTGCTGGCGCGCGACCTTCCGGTTTAGTGAAGTTCAGTCACGTGTTTAGTCACGTTGCTGGTTA
AGAGTCGCACCAGAATTGTTACCGAATAGTGGTCTCACCAAACAATTCGTCCGGGTTAAACTTTTAATGCGCGACCATTGGGAGGGGTTTTGGAAGGCAC
CATTGGGTCTTTCCGAAGTCGAATTTCATGCAAGAAAGTGCCAAAGCAACCACAAGTAGGGTTGTTGGAATGCTTCCAGTCGCCCAGGCACGCAATGGGC
GAGTATGAAGTATGCACGATTTACAGCAATTCGTACTCGAGTACGATTTATAGTTTTGTACAAGTCGTACGAATTAGAGGCGAAAGAGCCAAAAAAAAAA
AACTGCAAAGCACAATTCCGGTACATGTATTATTATTAATACAACACAAATTGGTTTTTATGGGCCTAATCTCAAATCGTCATCTTCAATCTCATCTGTT
CGCACCGAACTCTTGCAATTTTGTGTGCCTGGCTCATCGACTCTACGTATGCACGAGTGCGCTCTTGCATTTCTATCCACTTTGCTTTCGTTTCGCGAGC
TGACAGTCGTCAGACATCCATACGACTATGCTGTACACTCGCCTATTAGCAGCGTCGGCTCTGGCGAACGCTCTCCTGTTTCCGCAAGTCAACTCGGAGG
ACTACACGGTCAAGGCCGATCCCGCTACGACACTTATCAGTACCTGGGAAGGATGGGGCACATCGCTCTGCTGGTGGGCCAACGCCTTCGGAGACCGTGA
AGACATCGCTGACCTACTCTTCACCATGAAGGATACCGTGACGCTCGACGGTGCGTCATCTGGTCTCCCAGCGCTAGGCTTCAACATCGCGCGCTACAAT
ATCGGTGGGTCTGGCAAAAACGTCATCGACGACAGCGGCACCGAGATCGCGATGAAGGAGTCCAAGAACATGCCAGCCTTCAAGTTCATCGAATCGTTTT
GGCTCGACTGGTCGAGCAACGACACAGCCAGCAAAAGCTGGAATTGGGAAGCTGACGCTAAGCAGCGCAAAATGCTCGACTTGGCGACTCAGCGTGACGT
TGACATCACGGAGGCGTTCTCAAACTCGCCACCATGGTGGATGAACAGCAACCATGCGACTGCGGGCGGGGACAGCGGAACAAAAGATAACTTGCAATCC
TGGAATCATGGACAATTCGCGCTGTACCTGGCTACCGTAGTGAAACAGGCCAAGGAAAGCTGGGGAATCAACTTCACGTACGTTGTGCCGTTCAACGAGC
CTATGAGTACGTGGTGGCAGTATCCAGGTGGCCAGGAAGGCTGCCATTTTGAGGTGGACACCCAGAAGGATGTCGTATTGAAACTGCGCTCTAAGCTGGA
CTACTTTGGGCTGCAGGACGTAGCCATTTCCTCATCCGATGAAAACTCGGACACGCAGGCACTATCGACGCTCACTTCCATGTCGACGGACGCAGATGTG
ATGACTGCCATCGGAAAAATTAACACACACGGCTATGGTAACCGCGAGTCGGATCGGGCACCACTGAAGAAACTCGTGGAGCAGGTAAAGAAGAAGTTTT
GGGACTCCGAGTACGGCGAGAAGGACGCGACGGGACTCAGCTTGGCTGAGGCTGTTGCGATTAACATCAACCAAATGGGCGTGTCGGCGTTCGTCTACTG
GCAGCCGTTTGACGGCGGGGGCTGGGGCCTCATCAATTCTGCTCCGGGTAATTTGACGATCGACACGCCCAACCCCAAGTACTATGCGTTTGCTCAGTAC
TCGCGCCACATTCGACCCGGCATGGCGATCCTTTCTTCGGATGACACGAACACCGTCATGGCCTACGATACCGCGTCCAAACTCCTTGTACTTGCAACAG
TGAACTCAGGCGACACGGTTTCGAAGGTCACTTTTGACTTGGCGAGCTTTTCGAAAGTGACAGGGCCGATTAGTGCGTGGACGACGGAAACGAGCGGCAC
GGGTGCGCTTTACAAGTCCTCGAAGGTCGAGCTATCTGGCACGTCTTTCAGTGTGTCGATCCCGTCTGCGTCGGTGATGACTTTCGAGATCGAGGGAGTT
ACTGTTTAGACTTCGTGTTGAAATCGGTGATTTTGAACACCTTGGAAGAGTCTAACAAATAATGAAACGGATCAATTACATTAAGCTTTTTGTAATCATC
TGATCTAATCGAGGTTGCGTGGTTGAGCTTTCGACACCAAGCAATGCGTGATCTTTCACCGTGCCACAATCAACGCTTCAATCATGATGATCACTGCCCT
GTTCTCAGGTTTTTACACATCTGAATGTTGATCAGCCGGCTTTCGAACCACTACAGAACAGATCGGAGAAAGCCCACGAAGTACGGGTACGGCACCTGGG
GTACCTCGCTTGAGAGTCTCAAATCGCGTCTTTCACCTCTTCATCTGTTCGCACCGAACTACCGCACGATGCCTGGCTCACGGCCCGCAAGTTATCTTTC
AGGCTCCTGCATCACTCTGACAATAGCTCGTAGCACTCCTTTTCGGTTCCCACTTTCGCTTTTGCTCTCCGCACTTAGAAGACGTCCCAGTATTTCGCCA
TGATGCTCGCAGCTTCAGTGTTGTCCTGTGTGCTGCTCGCTGTTCAGTCTACGTGGGTGAATGCGGACTACACGGTCAAGGTTGATGCTGCCACGACGCT
TACAAGCTCGTGGGATGGATGGGGAACGTCGCTCTGTTGGTGGGCCAACGTCTTCGGAGATCGCGACGACATTGCTGACCTACTTTTCACTTTAAAGGAG
ACGGTGACGTTGAACGGCTCGACTACCGGCCTTCCGGCTTTGGGACTCACCATCGCGCGCTACAACATCGGAGGATCTGCCAGTAACGTCGTTGACGACA
GTGGCACGGAGGTCTCCATGCAGACTTCGGACCAAATGCCGGCATTCAAGTTCATGGATACCTTTTGGCTGGATTGGATGAGCGATGACCCAACAAGCAC
GAGCTGGAGCTGGGACGCAGATGTGAAGCAGCGTACAATGGTTGGCCTGGCCACTCAACGTGATGTCGACATTGTCGAAGCCTTCTCGAATTCGCCGCCG
TGGTGGATGACGAACAACCATGCTACTGCAGGTGGAGACGATGGCGATAAGGACAACTTGTCCGATTGGAATCACGATCAGTTCGCACTGTACTTGGCCA
CTGTCGTTAGTCATGCCAAGACTAGCTGGGGCATTAACATTACCTATGTCGAGCCCTTCAATGAGCCCATGAGTACGTGGTGGGAATACCCAGGTGGTCA
AGAAGGGTGTCACTTCGAAGTGGACACACAAAAGGACGTCTTGGTTAGACTGCGAGCTCAGTTGGACACCCTTGGCCTGCAGGACGTAGCGATTTCCTCA
TCCGATGAAAATTCGCCGACGCAGACACTGTCCACACTCACCTCCATGTCGACGGACACAGATGTAATGGCTACCATAAAAAAAATTAACACTCATGGTT
ACGACGGCCAGAGCCCGTACCGAGGAGGGGACCGCGGCTCCTTGAAAACGCTGGTGACCCAGTCGAATAAAAAGTTTTGGGACTCGGAATACGGCGAGGA
CGACGCGACCGGGCTAAGTCTGGCTGAGTCGATCGCACTCGACATCAATGAGATGGGTGTGTCGGCTTTTGTGTATTGGCAGGCACTGGACAGTGGAGCT
TGGGGTCTTGTTCAATCCAACCCGGGCGATAGCTGGATTGGCACGCCCAATCCAAAGTACTACGTGTTGACCCAGTACTCGCGACACATTCGACCCGGTA
TGGCTATCCTATCAACAGATGACACGAATACCGTCGTGGCTTTTGACGCCGCGTCGAAGCTTCTTGTGGTCGTGACGGTGAACTCGGGCGACTCGGCATC
TGCGGTCACTTTCGACTTGTCCAGCTTCACAACTGTGGGAGGTCCGATCACTGCCTGGACGACGGAGACGAGCGGCACGGGCGCGCTGCACGAGTCTTCG
AAGGTGGTTTTGTCAGGCACGTCATTCAGTGCGTCGATCCCTGCTGCGTCGGTCATGACGTTCGAGGTACAGGGCGTCGCAGCGTAGTTTCCCTTTTCAA
GCCACCGCAAATAAACATCATTTTCGACTGCCCACGATTTGCCCAGGAAAAATAGGCATGAACCATGCAGCCAGGGTCTGGCGACCGCCAATACAAGTTG
AAGTTGCTCTATCTTCATGCGGACTTGCAGCGCCTTGGTCTTCGTGCTTCATATAAGGTTCGGCGTGAGTTCTCATGTAGGCAGCTTGCAAGTTGTTGTT
CTCATTGTGTAGGCTTGCAGGTTGAAGGCCCCCGCACATAGGGCGTGTTCAGCCAATCAGATCTTCCCTTGAAACCAACGAAGCCAACACAAAGTCAGTG
ACTGGGGAACCCGAGGAGCTACGAAAATGGTGGACACGTCGGAGGTCCCGGCGCGTCCGGGTCAGATAACGACCGATTTCCTGCAGCAGATTCTGCGGCC
TTCGTATCCTTCGCAGCGCGTGGTCGACTTCCAGTGGACCCCCATGAACATTGGCGTGATCGCGGAGGTGGCGATCATCACAGTGGAGTTTGAGCGCGAC
GACGGCAGTGGCGAGGCCAAGAGAACGCAGCACAAGTTCGTGGGCAAGTTTCTGCGCCCGGAATTCCCGTTCGAGTCGATGTTCGCGGTGGAGTCCAAGT
TCTACAACGAGTTCACGACGAAGGCAGGCGACACAGCCATGAGGAACTCGGCGGCAACTGTGGGGTTTCCGTTCGCTATCCCGACTGTAGTCTTCACATC
CAACGTGCTGATCGTTCTGGAGTTTATCGATTCGACGAAGACCTTCACTTGCGTGGACGGAAGTCCACCCCAGCACATTCCGAAGCTGGTGACCAAACTC
GCGCAGATGCACGCGCGCTTCTGGAACCACGACTGCGATGGTCTCGCCGTTCCAGCGGGAATTGGCAGTCAGCTTACTGGTGAAGAGAAGCGCCTGCAAT
TCCCTGGCTGCTGGGCTGGTTACTTGGACGACGTGCCACTGGAAGCCAGTGACAAGGCGCAATTGACAGCGTTATGCCAGCAACTGAGCGAGAAGCCTGA
TAAGCTTAAAGTGGTGCACGACAAGGTGGACGATGGCCCGTCTTCGTTGATCCACGGTGACTTTCACATCGCAAACATGCTGCTATCGACGGATCCTGCA
GATGAAGTAACATGGCTCCTGGATTGGGCAACCTGTGGTAAGGGCAATCCACTGCGAGATCTTGCCTTTTTCTTTATCGTCAGTGTCCAAGCAGCGCACC
GCCGAGAACAAGAGGAACAGTGCTTGGAGATGTACCGCAATACATTAACAACAGAGCTGGAAGCTGCACAACTGCCGCTGGATGAACTGCATCGGCAGTA
TAAGATGTGCGTGTTGAACCAGTTCGTGATCCTGGTCGTGTACGACAGCCTCAGCAAAAGTCTCGCGGCGAACGCCAAGACCGAAAAGATGCGTGTGGAG
CTGGATGCACATTTTCGAGAGGTGAATCGCCGCGCGTGCTTGAGCGTCCTGGACAACGTCGTCGAGAAGGACCTCCAGCTTCTGCAATGAAGGCCTTGCC
TGAAAAATCAGCTGCTGTACGTGTAACTTCGATGGGTTTATACAATCGGAATCGGCGACTTGCTTGCTCCCAGTCAATTAAGGGCGTGTCTTCTGGATCG
GCTCGTTGCACAGCTGTTGTCGATACAGATTACGAGGCCGCTCGCATACGAAAGTAGTGTCGGTCGGCTACCGACTCGGCAGGCATGGGCGGAGTCAAAG
GGATCAGTTGTATTTTTACTCACAGCTATTGATACCGACCGGAACGGCACAGTCATCGCTCATGAAACCCTATCATTTCATATGTGTTTCTTATTAATTG
GGTGATATATACCTGTAATAATGAATATACCCTCATGTATAAGTTTATTTATTTGGATGATAAAACGAAGCGCTTACAGTACTCATTGTGCAGCCTGCTG
TGCCCGCCCGTCTCGTCCTGTGTGGCATAAAACGAAGAACCGAGAGGGGAGCAGGTGCACATCTCGGGCGCGAAGAAGAGCGGACATGGCGCGCTCGATC
CCCAAGCCCAACCCGATCCTGGACACCCTGCTGGTGAGTCTGCTCGTGTGCGAGCTGGTCGTCATCGTGCACACACTGTGGGATGACAAGCAGATGCTCT
ACATCCTCGTGGCCATGGTCTTCGTGGTGGCGCTGGCCGTCAAGGCCACAAAAACCTCGTTCGCCATCGGGGGCGGATGGTTTTCGCGCACGTTCTTGCA
GCACCTCGGGGACCCGCTCAAGAAGGCAGTGACTATGAAAAAGTGGTGCGACCAGTCGTGGCAGCTCGCCATCCACGTGTCCATGACGATCTTCGAGCTT
TATGTGCTGCGCGATGAAACCTGGTGGCAAGACACGACGACTTGTAAGGAATGGGCAACCTGAAAACTGTGTGGTGGGAGGACAAGATATCTTACTGTGT
CTATTATGTTTTCGTGTGGTGAATGACACTGCAGTGTGGAACCAGGGAACGGACACGGGCGTGTTCCCGACGCAGAAGTTTAGCACCAAGCTGCTTTACA
TCACGCAACTGGTGAGGGAGTGGCGTGCTTGTGTTACTGCGGACTTATTGGAAGCTGGTTAACGTTGTTTTGTACTTCGTAGGCGATCTGGATTTTCACT
GCGTTCTCGTGCAAGTTCCTAGAGGAGATCCGCAAGGACTACTTAGTGATGATGACTCACCATGTCGTCACAATTGCGCTGGTCACGTGGTCGTACGCTG
TTGGCTTTTTGCCTGTGGGTGTAGTCGTACTCCTTCTGCATGACATGACTGACATCCCTCTCGACATGCTCAAAATGGCCAACTACCTCAAGATGGAAGG
CGTCCCGGGTCTGTTCACGAGCGAAATCCTGTTCGTCATCACGATCGTGCTCTGGTTCTACTACCGCATCTACCAGTACCCGGTCAAGCTGCTCTACACG
ACGATTGTGGAGAACCGCGAGGCCAGCATGACAATGGCCAACGCACATGACTTCACGCAACTGTTCCCGTACCCAGGCCCTCCGTCGTGGCTGCTCTTCA
ACGTGCTGCTCACGACGCTGTACTGCCTACACATTTGGTGGGGCCTGCTGCTTGTGCGGGTGCTCGTTGGCGTGGTAACCAAGGGTACCCACGACACGGC
CAAGGAGGAGTACGAAGGCACATCTTCCGACTCGGACAACGAGAACAAAGACGACTAGAAAGCAACTGCATTGTTGGCGTGAAAGGACTAGAATGTGAAA
GAAGACAGCAATTTGACCAGAAGAGTAAGAAAATCGTCCTTCTTCAACTTGACCTTTACAACATCATAACGTATGCTATTATACAGGCCAATATTTGGCG
CGAGCATTTTGACAACCAGTGGGATAAGAAGGTCGCCAGCAACATGATGGAAGCGTTGGGCGATGCACCGCCGGTGTCGGTGCAGTCGCTGGTCACGGAG
GTGTCGATCGTAAAGGCCCTGCGAGAGTTGCTTCCGACCATGGACGCAGAAACGGCGACTCTGAAGTTGGTGATGCAGAAGCTGGCGGTTCGCTTCGGCA
TGGAGTTCCGGGATTTAAAAGCACAATGGAGACCTCACATCAAGGCGGTGCTGCCGGAGATGCTGGACCAGTGTCTGAGAGGAGAAGCGTCCGAAGAAGA
GGGCGAAAAGGACAAACACCGGGCGGAAGAGGAGGAGGAAGTTGATCTGCGGCCCAACCGGAAGCGCACGACTAGAAAGCACAATGCAGTTGTTGATGCG
AGTGATGAAGAGGCGGAGGAGGACACTGCTAGTGACAACGATGCAAGTGGAGGTGAAGAAGCTAATCCCGAAGAAGACGATGAAGAGGAGGAAGACGATA
TTGCTCCAGCCAAAAAGAGACTGAAAGCGGTGCGAACGTTGCTTTTGTTGGGTCTGACCTTTTCTCCTTCTTGTTACACCCTTCGAGGTATTATATGCTG
ATGCCTACTTTTTGCTGTTCTGGTTGTTTTTGCTTGCAGTCGAACAATGGCCACTCGAGTTGGAGATCAAGTAAAAGCGATGGTCCGCCGGTGAAGAAAG
CCAAGACTGTCAAACAACAAGATCCTCCGGGACTTGCCTCGTTGAAGGAACTGGGCCGTGCAGCTGGTGTAATGAAGTACGGGCTGGGTCCTATAGTATA
TCGAATTGTGTGGAAGTTCATGCTAACCAACTCGATTGTTTTGGGTTTCAGTCCACGGCTGTACAGATTTCTGAACGGTGCCACATCGACTGAAGACTCA
GAAGAGATCCTGCGCAAGCGATTACAAGATGCTGGCGTTGCCTTTAATGGCACGTATCCATCAAGCCGCGATATCAGCGCCGCGAAGAGAAAGCACGACA
AAGCAAAGGAGCTGGAGGGCATCGACACAAACCTGATTATTTCGGGCGGGAGGTCCCGTCGTGGTGGCTCGCAGCACATTTCCTACAAGGAAGAGCGGAT
CAGTGGGGAGGAAGACAACGCAGAAGAGGAGGAAGATGAAGATGACAAAGACGCCGAGGAGTTCGGTGGCAGCGACTCGGACTCGTCAGAGGCGTCATTT
TGAGTTGGCTTTTGCGTAGTGGCGATGTGAGTGCATATGCAGTAGTAGGTGGTCCTACCGCAAATAGAGAATTGCTTTCGTCTTGGGAGTGCAACGTTAG
TGTTGTTTAGCCCTTTCGTTTTTGTGATACAAGCAGTTTTTGTGGGACGATATTTGTGCACATCGACTGTCGAATCTCGCTCCAGATCAATTTGTTAAGG
GCACAAATCGGGTTTGTGTCCCATAAAGAAAGGTAATTCCAGATCTCACTTGCATTTCGTAAGGCGTCAAATTAAAATCATGTGATTGGATAAAATAGAA
AATGAACCACATGGGATTGGCCAAAAGTCGCCGGTAATTGCTTGTCCAGGTGATTGGTGGTGGGAGCGCGTGGCCTGTTTGGTCCCGGGCGGCGCAGCAT
TTGCCGCTCCAGTTTCCAGAACCCGAACGTGAAGCAAGAATCATGCCGTCCTACAGCCAGGAACCTGAAGACGCTCAGCGCGCCGCTAAGGCCCGTGGCT
CGCACCTGCGCGTGCACTTTAAGCACTGCCGTGAGGTCAGCCACGCCATCAAGGGCATGCCCCTGAACAAGGCTAAGAGCTTCCTGCAGGCCGTGCTCGA
GTACAAGCAGGCGGTGCCCTTCACCAAGTTCACGGGCGGTTGCGGCCGTCACGCTCAGGGCAAGCTCCGCGGTGCCGCTGGCGACAAGTGCAAGTGGCCC
CAGAAGGCCACCAAGATCATCCTGGACCTGGTGAAGAACGCCGAGGCCAACGCCGAGGTCAAGGGCCTGGACACGGACCTGCTGTACATCTCGCACGCGC
AGGCCAACGCCGCCATCAAGCAGCGCCGACGCACGTACCGTGCGCACGGTCGCATTGGACCCTACATGTCCAACCCGGCCCACATCGAGCTCATCCTGAC
GGAGAAGCGTGCTAACGTTGCCAAGGCCGTGGAGGAGGTCAAGCCCACCAAGGTCTCCCGCAAGCGTCAGGCTCAGCTGCGCCTCAAGTCGGGCGGCGGC
GTCCCGGCCAACTAAGTTGATTTCTTTGCTCGGGATATCTCTTGCCTGAAACACGAACGGTCAGTCGGGAACGAGCGACTGGAGACGCGAGGGGGTGGCG
AAAAGTTTGGTAAAACTTTTTAATACAGCCTTGCCGAGAAATGGGTTCTACTGATGCAGTGTCTGTTGCCAAGAGAGCAAGCGAGTTTCCAGTTCGTCTT
CATGGCGTGTCCCTGCGTAGGTCGTTATGGTTTGCTTTGGGTGCGTACAGTAACAGGTTTGATAGCGGCGGGACGGAAGTCGGGACTGAATTTGCTGCGC
CGGCTTAGGAGATGACAGGGGAGAGTCGTGATACCACCACTATGAGGTCGTCGGAAACTGGGGTAGCTAGGATGGTGGAGCGATATCCTGTGTGCTGACG
AAGACGAGATCACTGATGACGGCGTGGCTACCTGTGACGTTGAAGACCGAAGAAAGCAAGTCTAGCCATGCTTGTAGTCGATGCCGCGTCGGGAAGTGGA
CTACCCA