Description :
From Genome Similarity Track
Location :
Scaffold_28:317255- 318736
Transcript NameFunction/comments
g8911.t1hypothetical protein

Sequence
1481 bases(100 bases per row)
AGGTGCTTGGCACATTGAGCGCACCAGACCCAGCAAGTCCTTACTCCCTTCGGCATCAGTGATAAAAGCTCGGAGTCTGGAAGGAAGCGTAGCAGTACGT
CGATGCAAACCATAAAGCACGGTCATTGTCTGGAGCAGATCTGTAATAATCATTGCTGTGATAGCAGTAACACTCGACGCTGTTTGCATGCAAGTGGAGA
TGTAGACCGCATTGAAGAAGTCCACAGTAAATATAACGGCCTCGGGGGTCATATCTTCCATATGCGCAGTGCACCGCAACACAATAGTTTTCATGAAAAG
TTTAATCACAGGCAGAAGTAGGATAACTAGAACATGGTGGAAAGATCCTTGTGCAAGTCGGAACAAGGCCTCGTAGGATGGGTAGACGTATGCCATCAGG
AGCTGTACGCTCAGAAAGCAAACGTATCGCGTTAGCTGGTCGCGTTGGGCAAGTAGTTGGTTGGTGGTTCGAGATCCGAGGACAACTTTAAAGCTTAGAA
GCAGCACTATGGTGAACACGGGACTCATCATCAGTATGAAGAATGGAACAGGGAAAACTAGGCACGCTGAGATGGCCATCGCACAAATCGTGTAACAAAT
CGACGCCCAAGTAGACATCACAATTTTCCTCCATGTTGAAACACTGACTCCACGGATAAAGAACGAGACGTGAACAACCACTGAGTAGGTCCCAACGAAT
ACCATGATCATGACCCGAATCCAAAATCCAAAGTTGTTTTGCCAGCCATTAGTCGGGTCTTGCAGCGGCACCAGCTCTTGAGCAAGCACGAAGGAAAAAG
TGAGCAGGAACGGTATTACAGTCGAGACAAGTGTGGTTGGTGCCGACGCTGCACTGGTGAAGGTTTCTAGTGCGAGCACCCGCTCAATGGAGTACTTGCC
GCCGTAGTAGCTAACTTGCAGTCCCTTCCAGGCGCTGAAAAACTTGGAACACAGCTTCATTAGTGCTGTAAGCCCCATCGATTCAGCAACCGAGGACGAA
AACGTGGAATGGATTACAGTGCGAGTTTAGCTATTCGTGGCTCTACTTTCCAATTCTTGTTTATTGGCTTTACATATGGAAAAGAAGATACTACGTATAT
ATAGGTTTGAATACTGGAGGCTTGCCCTCAAGCAATACTTTACTTGTTACACAAGAGAGCATGAAACTTACAATCCTAGGTTGGGCGTTTGCGCCTTCGC
AGGATAGCGGGCAATAGTTTTTCAGAGCGCTGTATATTTCAAAGTATACTAGTGCTATACACTGTATACCTATTTTTCACCACTCCGATTTAGCGTAATT
CAGGTCGAAATATCCAATTCGACAGTTGAAGTCCATGCCCCACGATCGAGTATGGTCGCTACAAGCACGCCACGGCCTACTTCCTGGACTGGGTGTTGCA
GGCGCGTGGGCGTGATACGGGGCAGAAGGTGAAATTCGAGGCCATCAGCGACGTGGTGCGGGAGATCGCGGCGGACCCCGC