Description :
From Genome Similarity Track
Location :
contig_4:317248- 318560
Transcript NameFunction/comments
g1118.t1hypothetical protein

Sequence
1312 bases(100 bases per row)
ATGGACATCCTCGCTGGAGACAAGGTTACAGCTGTAGATGGTGTCTCCAAGACACCGCGGAGTCCACTATGATAGTTACATACCACACCTGGGCGGCTTC
TTCGGACGCTCAGGAAGTAATAAAACACTCTTTAGCCGTCAGCTGATCATTTAGGCCTTGTAGGACAGGAATTCGATGTGTATTTGTATTTGCTGCGGCT
ATGCCCGAGACGCGCTACGCTGTAGGACAGGAATTCGAGCGCCAGCGACTCGAAGTGCGAGAATGGACAAAACGGGTCCTGCGTGTGACCTGCATAAAAG
ACCTCCTCATTCTCGTAGTGTGGCTTGATAAAAACTTCGTGCGAGGCCTTGTCCTCGTACGCCTCGAACGCCAGCATCGTGCCGTGCTGAGGCAGCTGCG
ACCCCACATCAATCTGCAACACGCCCAGCAGCGCCACGATCGATCGAGTTATGGTGCGCTGGGAAGAAGGAGAGCTCGGCTGGCTGGCTGCTTGTTGTCC
ATCACCGCCTTCATAAAGCCGTACACCTCCTTCAGTTTGTTCTGAGCGCGTCGTAGCAAAAGCCCTTGCGATGGCACAGTCGCTGCCACAGCCCACCTCG
CTCGATCTTGCTCCTAGGCTGCACCACGTCGTCGTGTGCAATGAACTCGACCTCGTTGAACATTTGCAGCGGGTGCACGTAGAACTACGGCACCATGTGC
TGCTCGAAGAAGTCTCGAAGCGGACACAGCACCGACTCAGTGGTGCGCGGAACACTGCTCAGCAGCACGTAGACGTCGTCCGCCTGGACGTTGTCTCCAC
GAGCAGTCCGTATGGCTGTCTCTTGAGACATGACGGTCTGTTCCAGCAGCTCGACTGCTCGGTAGTGTGTCCACTGTGGAGGCCCACAAGTCCTTCTCCT
GCTGCGTGACCTGCACCTTCGTCCTGATGGGCCTGAGCACGGCCGTGCGGTGTGGAACATGTGCTACGTCGCGACTAGTCGAAGAGGTAGCCATTACACA
TCCCTGTTGCAGCCACTGTAGTCGAAGCTGTAGCCATTACAGGTCCCACTGTAAGTGACCCCACTGTAATGGCTACAGCTTCGACTAGCTGCAACAGGAT
GTGCCAGCAGCAGTAGCAGCACGGCTCGGCGAAGCAGCGTCTGTTGTTCTCCTTCTTCTTTCATCTTGAAGAGCTCGCTTCCACCGCTCGCCACTGTCAG
CAGCAGCTGATCCCATCGTCGCAGAGCGCTGGAGCCCACGCAGAGCCCTTGCGAGGTTTGCTGCTGGGGCCACAGCAGCGAGTGTGTTGGGATCGCTTTC
GGCCCAATAGTG