Description :
From Genome Similarity Track
Location :
Scaffold_266:31720- 33468
Sequence
1748 bases(100 bases per row)
GCTTGGTCAGGTGGTCCGTCTCTCACATCAAGGCCCGCAAAAGGTAGCGACAAAGATAAAAATGGAAGGGTTTACACTCACAAAGCACCCCCAAGGCCCA
GATCGCCCCTAGCCTCCGATTCGCGATCTTTAATACATCGATCGTAGCCTCGACCCCAACGACACAGCGTGAAGAACTTTCTGCGCCGCTGTCACTAGTT
CCCTTTACCCGGTCAAGGCAGCCCACGATCGACACAGATACTTCCTCTGAGACCACCCTAAGAGTGACCAGCCTTACTGACAACTACACAAGGCATGCAA
GATTTTTTGCATCCGACGGATACTGGCTTACCCactccgttagtcggtggttcggCCACCGTGTACAAGATGCCACTTCTCCACAATGGTCCACGTGTTC
GAATATTTGGATGACTCGAGATTTCACCGTGAATCCCTTGAAGAGGAAGTACAAGCTGAGATTGCGTCATGGAAGCTAGATTCAACGAAGATCGGATAAC
AGACGATGCCGCCCAAGCAAGATCGGCAGAGTTTTGAGAGGAGCTCTACCGATGCGCAGAGGAGGTCTGGTGACGGATTTGGTTGAAACATCTCGACCTC
CTCCCTAGGACCCTTCGGGGACCCCCGTGGATTTTTTTGATACGAATAAGGACCAGGGCCACCAGTGAAAGCTGGATACACTTCATCCACCCAGCCCCTG
GGTCAGGATCAAGAGCCAAGAAAAAACTGCGATATTGAAGCACTCGCAGAAAAAGAGGAGAGTTCCGGACTCCGATGTCGAGGTCGCAACAGTCTGGACC
GAGGAGAACCTGGAAGCTACGTACGACAGGAAGGATTTCCATGCCCTCCTGATACAGAGACGTTGAAACCTCTGGTTGGTAAGATCAGACAACCAACCAA
ACATAGGTTACTAGATCGCAGCCGACACCTACCCCAGACGCCCAGACCGGCACGTCTTCTCACTACGAGTATACAGCCGAGAAAGTGGACTCGGACAGCG
TTGGCGATCTGCAGCGAATGGGGCCTTCCGGTACTGCCGTGCTGCCAGGTCGAGTTGAATGTTCCTAGCGTGAATCAGTAGCTTATGCCCAAGCGCAGAA
GATCCCAGCCGCGAAGCCGACGCGCCACTCGTTCTGAGAAGCTGGAGTGTACTTTCAATCTGCGATGggcagcttcatgaagaaccagccccccccctcc
aCTTCTCCCCATGGGAATTTCATCCGGACGATCATGATCTTGCCGCCCCTGCCCACAGAGGAGTGACCACGGCGGCAATTCCACACACTGGAAAATCTAC
AGCTGCTCCACGCATCTGCGTATCAGCTGTGTTCGAACTGAAGTGGTCCACTAGAAAGTATGGCGACTTAGATCAACCCCGGTCCTGAATTGGCAAGGTG
AAGTTAGCGTTTACTTGAGATCAAGTACCTGATAAGGAAAATTGCGTGGTCTTCagcgatcttcttgctggacCAGCCCAAAACTGGTACCGCCAGCTGT
ACTGTACGACTCGCAGCGCGTGGAATATCTTCTTCAGACCTTCCAGACACATTATTGTGGCCTCGGTGTATCTGTCGAAAGTCACTACTACCACGCGCAG
AAGCGATCGGGCTAGTTGCCTTCGAGATATCTGCATCGTTTCAACTTGGCTGGCCTTAACGAGCGCCTCCGGATTAAGGATGGATAACCGAGGAACGTTC
GAACGAAATTGCCTATGAATCAATCAATCCTTGTTCGAAGAAcccagc